Effect of electroacupuncture on inflammatory signal expression in local tissues of rats with chronic pelvic pain syndrome based on purinergic 2X7 receptor/NOD-like receptor pyrin domain-containing 3 signal pathway

doi:10.19852/j.cnki.jtcm.20220928.003

Abstract

Abstract:

OBJECTIVES: To study the expression of inflammatory signal in local prostate tissue of chronic pelvic pain syndrome (CPPS) rats by electroacupuncture (EA) of Guanyuan (CV4), Zhongji (CV3), Huiyang (BL35) and Sanyinjiao (SP6), and to explore the possible mechanism of anti-inflammatory and analgesic effects of EA.

METHODS：A total of 36 Sprague-Dawley male rats were randomly divided into three groups: control, model and EA (n=12 rats/group). The CPPS model was made by injection of CFA into ventral lobes of the prostate (0.1 mL). Electric acupuncture apparatus was applied to stimulate Guanyuan (CV4), Zhongji (CV3), bilateral Huiyang (BL35) and Sanyinjiao (SP6) acupoints in EA group. The general condition of rats was observed and the prostate index (PI) was calculated. The thermal pain threshold was collected after each therapeutic course. Histopathological changes of the prostate tissue were examined by hematoxylin-eosin staining method. The expression levels of tumor necrosis factor α (TNF-α), interleukin-1β (IL-1β) and prostaglandin E2 (PGE2) in prostatic homogenates were measured by enzyme linked immunosorbent assay (ELISA). Moreover, the expression levels of purinergic 2X7 receptor (P2X7R), NOD-like receptor pyrin domain-containing 3 (NLRP3), caspase-1 and interleukin-18 (IL-18) mRNA were quantified by quantitative real-time polymerase chain reaction.

RESULTS: Compared with control group, the PI of rats increased, and the thermal pain threshold decreased significantly in model group. The morphological structure of prostate tissues of rats in model group was severely damaged with a large number of inflammatory cells infiltration. Additionally, the levels of TNF-α, IL-1β and PGE2 were higher, and the expressions of P2X7R, NLRP3, caspase-1 and IL-18 mRNA were higher than those in control group. After EA treatment, the PI was significantly decreased, the thermal pain threshold was significantly increased, and the tissue damage was significantly improved. The expressions of inflammatory cytokines were lower in EA group, and expression of P2X7R/NLRP3 pathway was down-regulated.

CONCLUSION: The effect of EA at Guanyuan (CV4), Zhongji (CV3), Huiyang (BL35) and Sanyinjiao (SP6) can improve inflammation and pain symptoms of CPPS rats induced by Complete Freund's adjuvant (CFA). This suggests that EA at Guanyuan (CV4), Zhongji (CV3), Huiyang (BL35) and Sanyinjiao (SP6) can produce anti-inflammatory analgesia effect by preventing the activation of P2X7R/NLRP3 signal pathway, inhibit the release of inflammatory cytokines in CPPS rats, which may provide a putative novel target for the treatment of CPPS.

Key words: electroacupuncture, inflammatory, cytokines, receptors, purinergic P2X7, NLR family, pyrin domain-containing 3 protein, signal transduction, chronic pelvic pain syndrome

XU Chang, LI Na, WU Xiaoling, DAI Xingye, YANG Zhiwen, SUN Qianhui, SHI Tianyu, CHAI Yemao, PANG Dandan, CHENG Kai. Effect of electroacupuncture on inflammatory signal expression in local tissues of rats with chronic pelvic pain syndrome based on purinergic 2X7 receptor/NOD-like receptor pyrin domain-containing 3 signal pathway[J]. Journal of Traditional Chinese Medicine, 2022, 42(6): 965-971.

Figures/Tables 7

Figure 1 Experimental design and procedure A: thermal stimulation pain threshold was tested prior to and after 5 d consecutive treatment of EA. a: day 1 to day 14: CPPS model establishment; b: behavioral test before EA; c: day 16 to day 20: the 1st treatment course of EA; d: behavioral test after the 1st treatment course of EA; e: repeat the 1st course of EA for a total of 4 courses. B: schematic diagram showing the location of acupoints [Guanyuan (CV4), Zhongji (CV3), Sanyinjiao (SP6), Huiyang (BL35)] of the rat. EA: electroacupuncture; CPPS: chronic pelvic pain syndrome.

Table 1 Primer sequence of detection genes

Gene	Primer sequence(5’-3’)
P2X7R	Forward primer: AGGTGGCAGTTCAGGGAGGAATC Reverse primer: TGTATTTGGGTTGACAGCGATGGG
NLRP3	Forward primer: GAGCTGGACCTCAGTGACAATGC Reverse primer: AGAACCAATGCGAGATCCTGACAAC
caspase-1	Forward primer: AAACACCCACTCGTACACGTCTTG Reverse primer: AGGTCAACATCAGCTCCGACTCTC
IL-18	Forward primer: GGCCTCTATTTGAAGATATGACTGATT Reverse primer: CCTCTAGGCTGGCTATCTTTATACATAC
GAPDH	Forward primer: ACCACAGTCCATGCCATCAC Reverse primer: TCCACCACCCTGTTGCTGTA

Table 2 Comparisons of body weight, wet weight of prostate and PI in rats ($\bar{x} \pm s$)

Group	n	Body weight (g)	Wet weight of prostate (mg)	PI
Control	8	405.69±16.77	452.55±21.46	1.12±0.07
Model	8	361.1±13.81^a	703.11±40.48^a	1.95±0.17^a
EA	8	399.43±17.95^b	473.56±25.13^b	1.19±0.09^b

Table 3 Thermal stimulation pain threshold of rats in each group at different time periods (s, $\bar{x} \pm s$)

Group	n	Before acupuncture	1st course	2nd course	3rd course	4th course
Control	10	11.2±0.8	11.0±0.9	10.9±0.8	10.8±1.1	10.6±0.5
Model	10	5.4±0.4^a	5.5±0.7^a	5.5±0.5^a	5.4±0.6^a	5.4±0.6^a
EA	10	5.6±0.5^a	6.0±0.5^a	6.7±0.6^a	8.0±0.7^b	10.0±0.7^b

Table 4 Expressions of TNF-α, IL-1β and PGE2 of rats in each group (ng/mL)

Group	n	TNF-α	IL-1β	PGE2
Control	8	114.4±6.7	42.3±9.8	144.1±25.7
Model	8	170.7±8.8^a	113.0±16.3^a	251.7±10.5^a
EA	8	118.7±9.4^b	52.6±13.3^b	153.6±27.8^b

Figure 2 Comparison of prostatic histomorphology in rats A-C: HE staining of rat prostate tissue. A: histomorphology of prostate in the control group (×100); B: histomorphology of prostate in the model group (×100). Box represents atrophy of glandular cavity and decrease of secretion, arrow represents inflammatory cells infiltration; C: histomorphology of prostate in the EA group (×100). HE: hematoxylin-eosin; EA: electroacupuncture.

Table 5 Comparison of the expression levels of P2X7R, NLRP3, Caspase-1 and IL-18 mRNA of each group ($\bar{x} \pm s$)

Group	n	P2X7R mRNA	NLRP3 mRNA	Caspase-1 mRNA	IL-18 mRNA
Control	6	1.20±0.68	1.12±0.53	1.10±0.61	1.04±0.35
Model	6	3.83±2.01^a	35.65±21.16^b	6.73±3.44^b	1.75±0.88^a
EA	6	1.73±1.02^c	1.54±0.39^d	2.05±1.53^c	1.09±0.25^c

References 36

[1]	Feng Y, Jiang S, Wang Z, et al. Oyster hydrolysate-zinc complex ameliorates carrageenan-induced rat prostatitis via an anti-inflammatory mechanism and reduced oxidative stress. J Funct Foods 2020; 72: 104066. DOI URL
[2]	Smothers A, Young S, Constantine L. Management of chronic nonbacterial prostatitis and chronic pelvic pain syndrome in the adult male patient with comorbid conditions. J Christ Nurs 2020; 37: E21-6.
[3]	Wang W, Muhammad N, Baig M, et al. Experimental rodent models of chronic prostatitis and evaluation criteria. Biomed pharmacother 2018; 108C: 1894-901.
[4]	Carter GT, Duong V, Ho S, et al. Side effects of commonly prescribed analgesic medications. Phys Med Rehabil Clin N Am 2014; 25: 457-70. DOI PMID
[5]	Natalia RN, Jyothi M, Jordan BK, Junjie M, Brandon KB. Cost-effectiveness of treatment options for neuropathic pain: a systematic review. Pharmaco Economics 2019; 37: 669-88. DOI URL
[6]	Watanabe S, Iwai T, Tanabe M. Intraplantar injection of sialidase reduces mechanical allodynia during inflammatory pain. J Pharmacol Sci 2017; 133: 49-52. DOI PMID
[7]	Xu ZF, Hong SH, Wang SJ, et al. Neuroendocrine-immune regulating mechanisms for the anti-inflammatory and analgesic actions of acupuncture. World J Tradit Chin Med 2020; 6: 384-92. DOI URL
[8]	Zhang K, Zeng X, Chen Y, et al. Therapeutic effects of Qian-Yu decoction and its three extracts on carrageenan-induced chronic prostatitis/chronic pelvic pain syndrome in rats. BMC Complement Altern Med 2017; 17: 75. DOI URL
[9]	Liu B, Long W, Wang RR. Electroacupuncture alleviates neuropathic pain by modulating Th2 infiltration and inhibiting microglial activation in the spinal cord of rats with spared nerve injury. World J Tradit Chin Med 2020; 6: 448-55. DOI URL
[10]	Radhakrishnan R, Nallu RS. Development and characterisation of a novel animal model of prostate inflammation-induced chronic pelvic pain. Inflammopharmacology 2009; 17: 23-8. DOI PMID
[11]	Huang AC, Liu M, Tsai T, et al. Low-frequency electroacupuncture at acupoints Guanyuan (CV4) and Zhongji (CV3) lengthen ejaculatory latency and improves sexual behavior in male rats. Chin J Physiol 2020; 63: 163-70. DOI URL
[12]	Wu Y, Jiang Y, Shao X, et al. Proteomics analysis of the amygdala in rats with CFA-induced pain aversion with electro-acupuncture stimulation. J Pain Res 2019; 12: 3067-78. DOI PMID
[13]	Liu Y, Liu LR, Wang XM. Electroacupuncture at points Baliao and Huiyang(BL35) for post-stroke detrusor overactivity. Neural Regen Res 2013; 8: 1663-72. DOI URL
[14]	Sun WP, Kou DQ, Yu ZJ, et al. A transcriptomic analysis of neuropathic pain in rat dorsal root ganglia following peripheral nerve injury. Neuromol Med 2020; 22: 250-63. DOI PMID
[15]	Fang JQ, Fang JF, Liang Y, Du JY. Electroacupuncture mediates extracellular signal-regulated kinase 1/2 pathways in the spinal cord of rats with inflammatory pain. BMC Complem Altern M 2014; 14: 285. DOI URL
[16]	Zhang W, Fang Y, Shi MF, et al. Optimal acupoint and session of acupuncture for patients with chronic prostatitis/chronic pelvic pain syndrome: a Meta-analysis. Transl Androl Urol 2021; 10: 143-53. DOI PMID
[17]	Zhang YQ, Ji GC, Wu GC, Zhao ZQ. Excitatory amino acid receptor antagonists and electroacupuncture synergetically inhibit carrageenan-induced behavioral hyperalgesia and spinal fos expression in rats. Pain 2002; 99: 525-35. DOI URL
[18]	Zheng HD, Wang ZQ, Li SS, et al. Effect of acupoints on acupuncture-moxibustion and its therapeutic mechanism. World J Tradit Chin Med 2020; 6:239-48. DOI URL
[19]	Xu ZF, Hong SH, Wang SJ, et al. Neuroendocrine-immune regulating mechanisms for the anti-inflammatory and analgesic actions of acupuncture. World J Tradit Chin Med 2020; 6:384-92. DOI URL
[20]	Lee SH, Lee BC. Use of acupuncture as a treatment method for chronic prostatitis/chronic pelvic pain syndromes. Curr Urol Rep 2011; 12: 288-96. DOI URL
[21]	Yang WY. Clinical observation on electroacupuncture at Zhongliao and Huiyang points in the treatment of overactive bladder. Beijing: Beijing TCM University, 2016: 32.
[22]	Shojaei-Zarghani S, Khosroushahi AY, Rafraf M. Oncopreventive effects of theanine and theobromine on dimethylhydrazine-induced colon cancer model. Biomed Pharmacother 2021; 134: 111140. DOI PMID
[23]	Li T, Sun L, Huang ZQ. Research progress on the mechanism of acupuncture in the treatment of chronic prostatitis/pelvic pain syndrome. Jiangsu Zhong Yi Yao 2021; 53: 78-82.
[24]	Lin SS, Chen YZ, Zhou XY, Wang J. Research progress on anti-inflammatory mechanism of acupuncture therapy for autoimmune diseases based on inflammatory cytokines. Guangming Zhong Yi 2021; 36: 3372-5.
[25]	He QX, Li XD. Research progress on the relationship between cytokines and chronic prostatitis. Zhong Hua Nan Ke Xue Za Zhi 2011; 17: 939-42.
[26]	Wan HJ. Expression and significance of NLRP3 inflammasome and its downstream factor IL-1β/IL-18 in rat model of allergic rhinitis. Zhengzhou: Zhengzhou University, 2015: 2.
[27]	Zhao YD, Wang XF, Wang JW, Han DY, Zhao ZT. Effects of warming-promotion needling on rats with chronic non-bacteriaI prostatitis on TNF-a and IL-β. Zhong Hua Zhong Yi Yao Xue Kan 2016; 34: 129-31.
[28]	Zhang J, Li X, Gao Y, et al. Effects of puerarin on the inflammatory role of burn-related procedural pain mediated by P2X7 receptors. Burns 2013; 39: 610-8. DOI PMID
[29]	Ismael S, Ahmed HA, Adris T, et al. The NLRP 3 inflammasome: a potential therapeutic target for traumatic brain injury. Neural Regen Res 2021; 16: 49-57. DOI URL
[30]	Zhang Y. Role and significance of P2X7R - mediated IL-1β in chronic abacterial prostatitis model. Anhui: Anhui Medical University, 2019: 28-9.
[31]	Garré JM, Silva HM, Lafaille JJ, Yang G. P2X7 receptor inhibition ameliorates dendritic spine pathology and social behavioral deficits in Rett syndrome mice. Nat Commun 2020; 11: 1784. DOI PMID
[32]	Friedle SA, Brautigam VM, Nikodemova M, Wright ML, Watters JJ. The P2X7-Egr pathway regulates nucleotide-dependent inflammatory gene expression in microglia. Glia 2011; 59: 1-13. DOI PMID
[33]	Wang W, Muhammad N, Baig MMFA, Abbas TM, Zhou X. Experimental rodent models of chronic prostatitis and evaluation criteria. Biomed Pharmacother 2018; 108: 1894-901. DOI PMID
[34]	Wagenlehner FME, Van Till JWO, Magri V, et al. National institutes of health chronic prostatitis symptom index (NIH-CPSI) symptom evaluation in multinational cohorts of patients with chronic prostatitis/chronic pelvic pain syndrome. Eur Urol 2013; 63: 953-9. DOI PMID
[35]	Yuan Z, Liu XL, Deng WT, et al. Correlation study of chronic nonbacterial prostatitis with the levels of COX-2 and PGE2 in prostatic secretion. Int Urol Nephrol 2014; 46: 1871-5. DOI PMID
[36]	Fulgenzi A, Ticozzi P, Gabel CA, et al. Periodate oxidized ATP (oATP) reduces hyperalgesia in mice: involvement of P2X7 receptors and implications for therapy. Int J Immunopath Ph 2008; 21: 61-71.

Home

Online First

Author Center

Reviewer Center

Issues

Announcement

About Us