Efficacy of electroacupuncture stimulating Zusanli (ST36) and Xuanzhong (GB39) on synovial angiogenesis in rats with adjuvant arthritis

doi:10.19852/j.cnki.jtcm.20221111.002

Abstract

Abstract:

OBJECTIVE: To investigate the efficacy of electroacupuncture (EA) stimulating Zusanli (ST36) and Xuanzhong (GB39) on synovial angiogenesis in rats with adjuvant arthritis (AA).
METHODS: AA models were established by bilateral injection of Freund’s complete adjuvant (FCA) in male Sprague-Dawley rats. Three days after injection, rats were given EA at Zusanli (ST36) and Xuanzhong (GB39) acupoints, once every other day, for 16 d. The arthritis index score, paw volume, and hematoxylin-eosin (HE) staining was performed for each animal. Angiogenesis marker cluster of differentiation 34 (CD34) expression and synovial cell apoptosis in synovial tissue were observed. The levels of Notch1, hairy and enhancer of split homolog-1 (Hes1), transforming growth factor-beta (TGF-β) and basic fibroblast growth factor (bFGF) were subsequently detected.
RESULTS: We found that EA significantly decreased arthritis index scores, paw volume, and HE staining scores. EA could significantly inhibit the expression of CD34, promoting apoptosis of synovial cells in the joint synovial tissue of AA rats. The expression of Notch1 signaling pathway proteins and mRNAs (Notch1, Hes1, TGF-β, and bFGF) were markedly downregulated by EA treatment.
CONCLUSIONS: These results prove that EA attenuates synovial angiogenesis by inhibiting the Notch1 signaling pathway in AA rat models. Based on our findings, we propose that EA is a promising complementary and alternative therapy in rheumatoid arthritis.

Key words: electroacupuncture, arthritis, experimental, synovial angiogenesis, receptor, Notch1, signal transduction

JIANG Jianzhen, ZHANG Xin, LUO Zhenguo, SU Chengguo, ZHOU Haiyan, JIANG Yuqing, XIAO Xianjun, CHEN Yunfei, ZHU Jun. Efficacy of electroacupuncture stimulating Zusanli (ST36) and Xuanzhong (GB39) on synovial angiogenesis in rats with adjuvant arthritis[J]. Journal of Traditional Chinese Medicine, 2023, 43(5): 955-962.

Figures/Tables 7

Table 1 Primers used for real-time quantitative PCR in this study

Gene		Primers sequence (5'-3')
β-Actin	Forward	TGTCACCAACTGGGACGATA
β-Actin	Reverse	GGGGTGTTGAAGGTCTCAAA
Notch1	Forward	TGCCGAGTGTGAGTGGGATGG
Notch1	Reverse	AAGTGGAAGGAGTTGTTGCGTAGC
Hes1	Forward	TCCTGACGGCCAATTTGCTTTCC
Hes1	Reverse	CTGGAAGGCGACACTGCGTTAG
TGF-β	Forward	GACCGCAACAACGCAATCTATGAC
TGF-β	Reverse	CTGGCACTGCTTCCCGAATGTC
bFGF	Forward	GAGCGACCCACACGTCAAACTAC
bFGF	Reverse	CAGCCGTCCATCTTCCTTCATAGC

Table 2 Effects of EA on arthritis index scores and paw volume in synovial tissue of ankle joint in AA rats (n = 8, $\bar{x}±s$)

Index	Group	Days after FCA injection
Index	Group	0	3rd	8rd	13rd	18rd
Arthritis index scores	Control	-	0	0	0	0
	AA	-	6.75±0.70	7.50±0.53	7.50±0.53	7.62±0.51^a
	AA+EA	-	7.75±0.46	7.37±0.51	6.25±0.46	5.50±0.53^ab
	AA+sham EA	-	7.37±0.51	7.25±0.46	6.87±0.35	6.75±0.70^a
Paw volume (mL)	Control	1.20±0.11	1.23±0.12	1.29±0.09	1.33±0.10	1.38±0.14^c
	AA	1.17±0.09	1.83±0.10	1.98±0.15	2.09±0.17	2.24±0.19^a
	AA+EA	1.20±0.13	1.83±0.09	2.02±0.13	1.97±0.15	1.89±0.13^ac
	AA+sham EA	1.21±0.12	1.87±0.15	2.09±0.11	2.13±0.14	2.16±0.16^a

Figure 1 Effects of EA on HE staining scores in synovial tissue of the ankle joint in AA rats A-D: HE staining pictures of groups Control, AA, AA+ EA and AA+ sham EA group (×200); E: HE staining scores. Representative HE-stained sections from the Control group, demonstrating no signs of inflammatory infiltration and synovial cells proliferation (A), the AA group and the AA + sham EA group illustrating massive accumulation of inflammatory cells, synovial proliferation and angiogenesis (B, D); and the AA + EA group, demonstrating less inflammatory cell infiltration, synovial proliferation and angiogenesis in the ankle joint (C). EA: electroacupuncture; HE: hematoxylin-eosin; AA: adjuvant arthritis. Data are shown as mean ± standard deviation (n = 8). Compared with the AA group, aP < 0.01; compared with the Control group, bP < 0.01.

Figure 2 Effects of EA on CD34 expression in synovial tissue of the ankle joint in AA rats A-D: CD34 immunohistochemistry pictures of groups.A: Control; B: AA; C: AA + EA; D: AA + sham EA group (×200); E: CD34 positive expression (IOD/Aera). HE-stained sections from the Control group, demonstrating CD34 was only expressed in a relatively small amount in the synovial tissue, the AA group and the AA + sham EA group illustrating a large number of CD34 expression in the synovial tissue, and the AA + EA group, demonstrating a less number of CD34 expression in the synovial tissue. Mean inflammation score (+SD) on a 3-point scale. EA: electroacupuncture; CD34: cluster of differentiation 34; AA: adjuvant arthritis; HE: hematoxylin-eosin. Data are shown as mean ± standard deviation (SD) (n = 8). Compared with the AA group, aP < 0.01; compared with the Control group, bP < 0.01.

Figure 3 Effects of EA on the apoptosis rate of synovial cells in synovial tissue of the ankle joint in AA rats A1-D1: TUNEL assay; A2-D2: counterstained with DAPI; A3-D3: merge pictures; A1-A3: pictures belonging to control group (×200); B1-B3: pictures belonging to AA group; C1-C3: pictures belonging to AA + EA group; D1-D3: pictures belonging to AA + EA + sham group. B: apoptosis rate. EA: electroacupuncture; AA: adjuvant arthritis; TUNEL: terminal deoxynucleotidyl transferase (Tdt) dUTP nick-end labeling; DAPI: 4′,6-diamidino-2-phenylindole. Data are shown as mean ± standard deviation (n = 8). Compared with the AA group, aP < 0.01; compared with the Control group, bP < 0.01.

Table 3 Effects of EA on Notch1 signaling mRNA expression in synovial tissue ($\bar{x}±s$)

Group	n	Notch1	Hes1	bFGF	TGF-β
Control	8	1.1±0.4^a	1.2±0.4^a	1.0±0.4^a	1.0±0.4^a
AA	8	52.4±17.1^b	58.8±21.7^b	73.2±18.9^b	43.7±15.8^b
AA+EA	8	4.1±1.9^ab	5.6±1.7^ab	5.4±1.9^ab	3.0±1.7^ab
AA+sham EA	8	30.8±11.9^b	38.0±16.1^b	49.5±17.1^b	25.0±9.0^b

Figure 4 Effects of EA on Notch1 signaling protein expression in synovial tissue. A: Western blot was used to detect the expression of Notch1, bFGF, TGF-β and Hes1; B: relative protein expression to GAPDH. 1: control group; 2: AA group; 3: AA + EA group; 4: AA + sham EA group. EA: electroacupuncture; FCA: freund’s complete adjuvant; AA: adjuvant arthritis; Hes1: hairy and enhancer of split homolog-1; bFGF: basic fibroblast growth factor; TGF-β: transforming growth factor-beta; GAPDH: glyceraldehyde-3-phosphate dehydrogenase. Data are shown as mean ± standard deviation (n = 8). Compared with the AA group, aP < 0.01; compared with the Control group, bP < 0.01 and cP < 0.05.

References 32.

1.	Aletaha D, Smolen JS. Diagnosis and management of rheumatoid arthritis: a review. JAMA 2018; 320: 1360-72. DOI PMID
2.	Veale DJ, Orr C, Fearon U. Cellular and molecular perspectives in rheumatoid arthritis. Semin Immunopathol 2017; 39: 343-54. DOI PMID
3.	Elshabrawy HA, Chen Z, Volin MV, Ravella S, Virupannavar S, Shahrara S. The pathogenic role of angiogenesis in rheumatoid arthritis, Angiogenesis 2015; 18: 433-48.
4.	Hao F, Wang Q, Liu L, et al. Effect of moxibustion on autophagy and the inflammatory response of synovial cells in rheumatoid arthritis model rat. J Tradit Chin Med 2022; 42: 73-82. DOI PMID
5.	MacDonald IJ, Liu SC, Su CM, Wang YH, Tsai CH, Tang CH. Implications of angiogenesis involvement in arthritis. Int J Mol Sci 2018; 19: 2012. DOI URL
6.	Sun W, Zhang H, Wang H, et al. Targeting Notch-activated M1 macrophages attenuates joint tissue damage in a mouse model of inflammatory arthritis. J Bone Miner Res 2017; 32: 1469-80. DOI PMID
7.	Jiao Z, Wang W, Guo M, et al. Expression analysis of Notch-related molecules in peripheral blood T helper cells of patients with rheumatoid arthritis. Scand J Rheumatol 2010; 39: 26-32. DOI PMID
8.	Keewan E, Naser SA. Notch-1 signaling modulates macrophage polarization and immune defense against mycobacterium avium paratuberculosis infection in inflammatory diseases. Microorganisms 2020; 8: 1006. DOI URL
9.	An L, Li Z, Shi L, et al. Inflammation-targeted celastrol nanodrug attenuates collagen-induced arthritis through NF-κB and Notch1 pathways. Nano Lett 2020; 20: 7728-36. DOI URL
10.	Liu Q, Allen TD, Song W, Wada Y, Lobe CG, Liu J. Notch1 activates angiogenic regulator Netrin4 in endothelial cells. J Cell Mol Med 2019; 23: 3762-66. DOI PMID
11.	Gao W, Sweeney C, Walsh C, et al. Notch signalling pathways mediate synovial angiogenesis in response to vascular endothelial growth factor and angiopoietin 2. Ann Rheum Dis 2013; 72: 1080-88. DOI PMID
12.	Zeng C, Bai X, Qin H, Wang H, Rong X, Yan J. Effect of adjuvant therapy with electroacupuncture on bone turnover markers and interleukin 17 in patients with rheumatoid arthritis. J Tradit Chin Med 2019; 39: 582-6. PMID
13.	Zhou Y, Zhu J, Li LB, et al. Effects of electroacupuncture on joint function in rheumatoid arthritis patients of liver-and kidney-Yin deficiency type. Zhen Ci Yan Jiu 2016; 41: 440-6.
14.	Ouyang BS, Gao J, Che JL, et al. Effect of electro-acupuncture on tumor necrosis factor-α and vascular endothelial growth factor in peripheral blood and joint synovia of patients with rheumatoid arthritis. Chin J Integr Med 2011; 17: 505-9. DOI PMID
15.	Gusmão JNFM, Fonseca KM, Ferreira BSP, et al. Electroacupuncture reduces inflammation but not bone loss on periodontitis in arthritic rats. Inflammation 2021; 44: 116-28. DOI
16.	Du ZH, Zhang CW, Xie WX, et al. Adenosine A2A receptor mediates inhibition of synovitis and osteoclastogenesis after electroacupuncture in rats with collagen-induced arthritis. Evid Based Complement Alternat Med 2019; 2019: 4617464.
17.	Zhu J, Su CG, Chen YZ, Hao X, Jiang JZ. Electroacupuncture on ST36 and GB39 acupoints inhibits synovial angiogenesis via downregulating HIF-1α/VEGF expression in a rat model of adjuvant arthritis. Evid Based Complement Alternat Med 2019; 2019: 5741931.
18.	Su CG, Chen YZ, Chen YF, et al. Effect of electroacupuncture at the ST36 and GB39 acupoints on apoptosis by regulating the p53 signaling pathway in adjuvant arthritis rats. Mol Med Rep 2019; 20: 4101-10. DOI PMID
19.	Leech M, Metz C, Santos L, et al. Involvement of macrophage migration inhibitory factor in the evolution of rat adjuvant arthritis. Arthritis Rheum 1998; 41: 910-17. DOI URL
20.	Ierna M, Kerr A, Scales H, Berge K, Griinari M. Supplementation of diet with krill oil protects against experimental rheumatoid arthritis. BMC Musculoskelet Disord 2010; 11: 136. DOI URL
21.	Majchrzak K, Kaspera W, Szymaś J, Bobek-Billewicz B, Hebda A, Majchrzak H. Markers of angiogenesis (CD31, CD34, rCBV) and their prognostic value in low-grade gliomas. Neurol Neurochir Pol 2013; 47: 325-31. DOI PMID
22.	Balogh E, Biniecka M, Fearon U, Veale DJ, Szekanecz Z. Angiogenesis in inflammatory arthritis. Isr Med Assoc J 2019; 5: 345-52. PMID
23.	Liu Z, Liu Y, Xu H, et al. Effect of electroacupuncture on urinary leakage among women with stress urinary incontinence: a randomized clinical trial. JAMA 2017; 317: 2493-501. DOI PMID
24.	Maracle CX, Kucharzewska P, Helder B, et al. Targeting non-canonical nuclear factor-κB signalling attenuates neo-vascularization in a novel 3D model of rheumatoid arthritis synovial angiogenesis. Rheumatology (Oxford) 2017; 56: 294-302.
25.	Nygaard G, Firestein GS. Restoring synovial homeostasis in rheumatoid arthritis by targeting fibroblast-like synoviocytes. Nat Rev Rheumatol 2020; 16: 316-33. DOI PMID
26.	Zhi LQ, Zhong Q, Ma JB, Xiao L, Yao SX, Wang X. LncRNA H19 inhibitor represses synovial cell proliferation and apoptosis in rats with rheumatoid arthritis via Notch signaling pathway. Eur Rev Med Pharmacol Sci 2020; 24: 4088-94.
27.	Kim MJ, Park JS, Lee SJ, et al. Notch1 targeting siRNA delivery nanoparticles for rheumatoid arthritis therapy. J Control Release 2015; 216: 140-8. DOI URL
28.	Li X, Dong Y, Yin H, Qi Z, Wang D, Ren S. Mesenchymal stem cells induced regulatory dendritic cells from hemopoietic progenitor cells through Notch pathway and TGF-β synergistically. Immunol Lett 2020; 222: 49-57. DOI PMID
29.	Ma MJ, Liu HC, Qu XQ, Wang JL. Matrix metalloproteinase-3 gene polymorphism and its mRNA expression in rheumatoid arthritis. Genet Mol Res 2015; 14: 15652-59. DOI PMID
30.	Gossage DL, Cieslarová B, Ap S, et al. Phase 1b study of the safety, pharmacokinetics, and disease-related outcomes of the matrix metalloproteinase-9 inhibitor andecaliximab in patients with rheumatoid arthritis. Clin Ther 2018; 40: 156-65. DOI PMID
31.	Zou W, Chen QX, Sun XW, et al. Acupuncture inhibits Notch1 and Hes1 protein expression in the basal ganglia of rats with cerebral hemorrhage. Neural Regen Res. 2015; 10: 457-62. DOI PMID
32.	Guo HD, Tian JX, Zhu J, et al. Electroacupuncture suppressed neuronal apoptosis and improved cognitive impairment in the AD model rats possibly via downregulation of Notch signaling pathway. Evid Based Complement Alternat Med 2015; 2015: 393569.

[1]	QIN Xiaoyu, WANG Chunai, XUE Jianjun, ZHANG Jie, LU Xiaoting, DING Shengshuang, GE Long, WANG Minzhen. Efficacy of electroacupuncture on myocardial protection and postoperative rehabilitation in patients undergoing cardiac surgery with cardiopulmonary bypass: a systematic review and Meta-analysis [J]. Journal of Traditional Chinese Medicine, 2024, 44(1): 1-15.
[2]	CHANG Fengjin, ZHOU Peng, LI Guoying, ZHANG Weizhi, ZHANG Yanyan, PENG Daiyin, CHEN Guangliang. Taohong Siwu decoction (桃红四物汤) ameliorates atherosclerosis in rats possibly through toll-like receptor 4/myeloid differentiation primary response protein 88/nuclear factor-κB signal pathway [J]. Journal of Traditional Chinese Medicine, 2024, 44(1): 103-112.
[3]	SUN Qianhui, CHENG Kai, DAI Xingye, YANG Zhiwen, WU Xiaoling, XU Chang, QIU Xinghua, GAO Xiaofeng, LIU Daonan, YANG Qirui. Effect of electroacupuncture at Neiguan (PC6) at different time points on myocardial ischemia reperfusion arrhythmia in rats [J]. Journal of Traditional Chinese Medicine, 2024, 44(1): 113-121.
[4]	ZHI Guoguo, SHAO Bingjie, ZHENG Tianyan, JI Shaoxiu, LI Jingwei, DANG Yanni, LIU Feng, WANG Dong. Efficacy of Ganshuang granules (肝爽颗粒) on non-alcoholic fatty liver and underlying mechanism: a network pharmacology and experimental verification [J]. Journal of Traditional Chinese Medicine, 2024, 44(1): 122-130.
[5]	LIU Huihui, FENG Jun, LIU Jianhe, CHENG Choufu, HU Guoheng. Efficacy of Jiangzhi Xiaoban tablet (降脂消斑片) on toll-like receptor 4/nuclear factor-kappa B/nod-like receptor protein 3 signaling pathway in mice with atherosclerosis induced by high-fat diet [J]. Journal of Traditional Chinese Medicine, 2024, 44(1): 88-94.
[6]	LI Xiaohua, DUAN Zhihang, YUE Jianjun, ZHANG Yongyu, LI Yihang, LIU Shifang, NIE Qu, YANG Depo, ZHANG Lixia. Bornyl acetate extracted from Sharen (Fructus Amomi) inhibits proliferation, invasion and induces apoptosis by suppressing phosphatidylinositol-3-kinase/protein kinase B signaling in colorectal cancer [J]. Journal of Traditional Chinese Medicine, 2023, 43(6): 1081-1091.
[7]	DU Zhongheng, CONG Wenjie, TANG Kejing, ZHENG Qiqi, SONG Zhiwei, CHEN Yong, YANG Su, ZHANG Chunwu, YE Tianshen. Electroacupuncture stimulating Zusanli (ST36), Sanyinjiao (SP6) in mice with collagen-induced arthritis leads to adenosine A2A receptor-mediated alteration of p38α mitogen-activated protein kinase signaling and inhibition of osteoclastogenesis [J]. Journal of Traditional Chinese Medicine, 2023, 43(6): 1103-1109.
[8]	LIU Yue, ZHANG Fan, HAN Xiaomeng, XU Ningyang, ZHAO Yu, WANG Qige, WANG Jianan, LU Bingjiu, Zhang Yan. Jianpi Qutan Fang (健脾祛痰方) induces anti-atherosclerosis and ameliorates endothelial cell injury in high-fat diet rats via an anti-inflammatory and inhibiting Janus kinase/signal transducer and activator of transcription signaling pathway [J]. Journal of Traditional Chinese Medicine, 2023, 43(6): 1168-1175.
[9]	WANG Miao, ZHU Yan, ZHAO Hui, ZHAO Hongfang. Moxibustion enables protective effects on rheumatoid arthritis-induced myocardial injury via transforming growth factor beta1 signaling and metabolic reprogramming [J]. Journal of Traditional Chinese Medicine, 2023, 43(6): 1190-1199.
[10]	YANG Xirui, ZHAO Hui, SHAN Muhammad, DONG Feixue, ZHANG Dandan, WANG Jixue, YUAN Xingxing. Efficacy of bioactive compounds of Chaihu (Radix Bupleuri Chinensis) on glaucomatous optic atrophy through interleukin-6/hypoxia inducible factor-1α signal pathway [J]. Journal of Traditional Chinese Medicine, 2023, 43(6): 1219-1226.
[11]	YANG Xiaohui, WANG Jian, CHENG Li, ZHANG Yuxi, HUANG Jianlin, LIU Minghua. Active compounds of Caodoukou (Semen Alpinia Katsumadai) inhibit the migration, invasion and metastasis of human pancreatic cancer cells by targeting phosphoinosmde-3-kinase/ protein kinase B/mammalian target of rapamycin pathway [J]. Journal of Traditional Chinese Medicine, 2023, 43(5): 876-886.
[12]	LIU Bingbing, LI Jieru, SI Jianchao, CHEN Qi, YANG Shengchang, JI Ensheng. Ginsenoside Rb1 alleviates chronic intermittent hypoxia-induced diabetic cardiomyopathy in db/db mice by regulating the adenosine monophosphate-activated protein kinase/Nrf2/heme oxygenase-1 signaling pathway [J]. Journal of Traditional Chinese Medicine, 2023, 43(5): 906-914.
[13]	LI Zhihao, HAN Wenjun, SONG Xiuling, LI Yan, CHEN Yuelai. Electroacupuncture stimulating Zhongji (CV3), Guanyuan (CV4), and bilateral Dahe (KI12) attenuates inflammation in rats with chronic nonbacterial prostatitis induced by estradiol through inhibiting toll-like receptor 4 pathway [J]. Journal of Traditional Chinese Medicine, 2023, 43(5): 963-972.
[14]	DING Luobin, WANG Huajun, LI Yao, LI Jia, LI Ling, GAO Yangping, GUAN Jian, GENG Weiqiang. Electroacupuncture stimulating Neixiyan (EX-LE5) and Dubi (ST35) alleviates osteoarthritis in rats induced by anterior cruciate ligament transaction via affecting DNA methylation regulated transcription of miR-146a and miR-140-5p [J]. Journal of Traditional Chinese Medicine, 2023, 43(5): 983-990.
[15]	SUN Mengzhu, ZHANG Yujie, SONG Yafang, GUO Jing, WANG Yuhang, XIN Chen, GU Dongmei, SUN Jianhua, PEI Lixia. Electroacupuncture alleviates water avoidance stress-induced irritable bowel syndrome in mice by improving intestinal barrier functions and suppressing the expression of inflammatory cytokines [J]. Journal of Traditional Chinese Medicine, 2023, 43(3): 494-500.

Home

Online First

Author Center

Reviewer Center

Issues

Announcement

About Us