Journal of Traditional Chinese Medicine ›› 2022, Vol. 42 ›› Issue (5): 781-787.DOI: 10.19852/j.cnki.jtcm.20211214.002
• Research Articles • Previous Articles Next Articles
Electroacupuncture attenuates chronic salpingitis via transforming growth factor-β1/p38 mitogen-activated protein kinase signaling pathway
HU Xijiao1, CHENG Yinglong2, KANG Huanan3, LI Shuoxi4, WANG Yawen5, LIU Jinzhe6, SUN Yiming7(
), LIU Li8()
- 1 Department of obstetrics and gynecology, the Second Affiliated Hospital of Heilongjiang University of Chinese Medicine, Heilongjiang 150001, China
2 Deapartment of Hysteroscopy chamber, the First Affiliated Hospital of Heilongjiang University of Chinese Medicine, Harbin 150040, China
3 College of pharmacy, Heilongjiang University of Chinese Medicine, Harbin 150040, China
4 Midwifery Teaching and Research Section, Heilongjiang University of Chinese Medicine Jiamusi College, Harbin 150040, China
5 The department of obstetrics and gynecology, the First Affiliated Hospital of Henan University of Chinese Medicine, Henan 450000, China
6 Department of Chinese Pharmacy, School of Pharmacy, Guizhou University of Chinese Medicine, Guizhou 550000, China
7 Andrology department Heilongjiang Academy of Traditional Chinese Medicine, Harbin 150036, China
8 Endoscopy room, the First Affiliated Hospital of Heilongjiang University of Traditional Chinese Medicine, Hysteroscopy Department, Harbin 150040, China
-
Received:2021-06-12Accepted:2021-09-21Online:2022-10-15Published:2021-12-14 -
Contact:SUN Yiming,LIU Li -
About author:Dr. LIU Li, Endoscopy room, the First Affiliated Hospital of Heilongjiang University of Traditional Chinese Medicine, Hysteroscopy Department, Harbin 150040, China. lunwenfabiao2021@163.com Telephone: +86-15045023666
Dr. SUN Yiming, Andrology department, Heilongjiang Academy of Traditional Chinese Medicine, Harbin 150036, China. sym19660104@163.com.
-
Supported by:Scientific Research Project of Heilongjiang Administration of Traditional Chinese Medicine (ZHY18-087): Clinical Study on the Treatment of Tubal Inflammatory Infertility with Gexia Zhuyu Decoction Combined with Hysteroscopic Tubal Fluid Passage;Natural Science Foundation of Heilongjiang Province (H2015026): Study on the Effect of Activating Blood Circulation and Removing Blood Stasis, Activating Qi and Relieving Pain on Salpingitis Infertile Rat Model. Mechanism of Gexia Zhuyu Decoction Improved Fallopian Tube Fibrosis in the Treatment of Salpingitic Obstructive Infertility based on Transforming Growth Factor-Β1/Phosphorylation38 Mitogen-Activated Protein Kinase Pathway(2021ZYGLG001)
Cite this article
HU Xijiao, CHENG Yinglong, KANG Huanan, LI Shuoxi, WANG Yawen, LIU Jinzhe, SUN Yiming, LIU Li. Electroacupuncture attenuates chronic salpingitis via transforming growth factor-β1/p38 mitogen-activated protein kinase signaling pathway[J]. Journal of Traditional Chinese Medicine, 2022, 42(5): 781-787.
share this article
Table 1 Primers sequences
| Gene | Forward sequence | Reverse primer |
|---|---|---|
| GAPDH | F: TGGCCTTCCGTGTTCCTAC | R: GAGTTGCTGTTGAAGTCGCA |
| TGF-β1 | F: ATTCCTGGCGTTACCTT | R: AGCCCTGTATTCCGTCT |
Table 1 Primers sequences
| Gene | Forward sequence | Reverse primer |
|---|---|---|
| GAPDH | F: TGGCCTTCCGTGTTCCTAC | R: GAGTTGCTGTTGAAGTCGCA |
| TGF-β1 | F: ATTCCTGGCGTTACCTT | R: AGCCCTGTATTCCGTCT |
Figure 1 Effect of EA on the pathological changes in oviduct A-C: HE staining was used to observes the pathological changes (× 100); D-E: Masson staining was used to observe the collagen deposition which showed show blue (× 100); G: collagen area was counted by Image pro software. HE: hematoxylin-eosin; EA: electroacupuncture. Data are expressed as mean ±?standard deviation of three independent experiments. aP?<?0.05 compared with Normal group; bP?<?0.05 compared with Model group.
Figure 1 Effect of EA on the pathological changes in oviduct A-C: HE staining was used to observes the pathological changes (× 100); D-E: Masson staining was used to observe the collagen deposition which showed show blue (× 100); G: collagen area was counted by Image pro software. HE: hematoxylin-eosin; EA: electroacupuncture. Data are expressed as mean ±?standard deviation of three independent experiments. aP?<?0.05 compared with Normal group; bP?<?0.05 compared with Model group.
Figure 2 Effect of EA on the expressions of TGF-β1 A-I: expression of TGF-β1 was measured Immunofluorescence technique. The red color represents TGF-β1 staining, the blue color represents nuclei staining, and the cyan (red-blue) color represents nuclear translocation (original magnification, × 200); J-K: expression of TGF-β1 was measured by immunohistochemical analysis (× 200, brown yellow granules indicate positive reaction); M: The expression of TGF-β1 were counted by Image pro software; N-P: expression of TGF-β1 in serum and oviduct tissue were measured by ELISA kit and WB methods, respectively; Q: TGF-β1 mRNA expression was detected by RT-PCR. TGF-β1: transforming growth factor beta-1; ELISA: enzyme-linked immunosorbent assay; RT-PCR: reversetranscription-polymerase chain reaction; EA: electro-acupuncture. Data are expressed as mean?±?standard deviation of three independent experiments. aP?<?0.01 compared with Normal group; bP?<?0.01 compared with Model group.
Figure 2 Effect of EA on the expressions of TGF-β1 A-I: expression of TGF-β1 was measured Immunofluorescence technique. The red color represents TGF-β1 staining, the blue color represents nuclei staining, and the cyan (red-blue) color represents nuclear translocation (original magnification, × 200); J-K: expression of TGF-β1 was measured by immunohistochemical analysis (× 200, brown yellow granules indicate positive reaction); M: The expression of TGF-β1 were counted by Image pro software; N-P: expression of TGF-β1 in serum and oviduct tissue were measured by ELISA kit and WB methods, respectively; Q: TGF-β1 mRNA expression was detected by RT-PCR. TGF-β1: transforming growth factor beta-1; ELISA: enzyme-linked immunosorbent assay; RT-PCR: reversetranscription-polymerase chain reaction; EA: electro-acupuncture. Data are expressed as mean?±?standard deviation of three independent experiments. aP?<?0.01 compared with Normal group; bP?<?0.01 compared with Model group.
Figure 3 EA regulated the p38 signaling way A-I: expression of p-P38 was measured Immunofluorescence technique. The red color represents p-P38 staining, the blue color represents nuclei staining, and the cyan (red-blue) color represents nuclear translocation (original magnification, ×200); J-O: expression of P38 and p-P38 were measured by immunohistochemical analysis (×200, brown yellow granules indicate positive reaction); P-Q: expression of P38 and p-P38 were counted by Image pro software; R: expression of p-P38 and P38 protein in oviduct tissue were measured by WB; S: p-P38/P38 expression was detected was counted. WB: Western blot; EA: electro-acupuncture. Data are expressed as mean?±?standard deviation of three independent experiments. aP?<?0.01 compared with Normal group; bP?<?0.01 compared with Model group.
Figure 3 EA regulated the p38 signaling way A-I: expression of p-P38 was measured Immunofluorescence technique. The red color represents p-P38 staining, the blue color represents nuclei staining, and the cyan (red-blue) color represents nuclear translocation (original magnification, ×200); J-O: expression of P38 and p-P38 were measured by immunohistochemical analysis (×200, brown yellow granules indicate positive reaction); P-Q: expression of P38 and p-P38 were counted by Image pro software; R: expression of p-P38 and P38 protein in oviduct tissue were measured by WB; S: p-P38/P38 expression was detected was counted. WB: Western blot; EA: electro-acupuncture. Data are expressed as mean?±?standard deviation of three independent experiments. aP?<?0.01 compared with Normal group; bP?<?0.01 compared with Model group.
| 1. |
Dun EC, Nezhat CH. Tubal factor infertility: diagnosis and management in the era of assisted reproductive technology. Obstet Gynecol Clin North Am 2012; 39: 551-66.
DOI URL |
| 2. |
Miller JH, Weinberg RK, Canino NL, Klein NA, Soules MR. The pattern of infertility diagnoses in women of advanced reproductive age. Am J Obstet Gynecol 1999; 181: 952-7.
PMID |
| 3 |
Li Z, Zhang Z, Ming WK, Chen X, Xiao XM. Tracing GFP-labeled WJMSCs in vivo using a chronic salpingitis model: an animal experiment. Stem Cell Res Ther 2017; 8: 272.
DOI URL |
| 4 |
Liao W, Tang X, Li X, Li T. Therapeutic effect of human umbilical cord mesenchymal stem cells on tubal factor infertility using a chronic salpingitis murine model. Arch Gynecol Obstet 2019; 300: 421-29.
DOI URL |
| 5. | Ma K, Wang KL, Chen YX. Infertility caused by salpingitis treated based on theory of kidney deficiency and blood stasis. Zhong Guo Zhong Yao Za Zhi 2019; 44 :1099-103. |
| 6. |
Stener-Victorin E, Waldenström U, Tägnfors U, Lundeberg T, Lindstedt G, Janson Po. Effects of Electroacupuncture on anovulation in women with polycystic ovary syndrome. Acta Obstet Gyn Scan 2000; 79: 180-8.
PMID |
| 7. |
Mo X, Li D, Pu Y, Xi G, Le X, Fu Z. Clinical studies on the mechanism for acupuncture stimulation of ovulation. J Tradit Chin Med 1993; 13: 115-9.
PMID |
| 8. | Lyttleton J. Treatment of infertility with Chinese Medicine. 2nd ed. Orlando: Elsevier Health Sciences, 2013: 250-71. |
| 9. |
Chen BY. Acupuncture normalizes dysfunction of hypothalamic-pituitary-ovarian axis. Acupuncture Electro 1997; 22: 97-108.
PMID |
| 10. |
Chang R, Chung PH, Rosenwaks Z. Role of acupuncture in the treatment of female infertility. Fertil Steril 2002; 78: 1149-153.
DOI URL |
| 11. | Titova N, Khashukoeva A, Korneev B. Acupuncture therapy in the comprehensive treatment of salpingo-oophoritis. Akush Ginekol 1991; 44-7. |
| 12. | Zhang X, Wei Y, Jiang J, Wang L, Liang H, Lei C. Effect of TGF-β1 on myocardial cell apoptosis in rats with acute myocardial infarction via MAPK signaling pathway. Eur Rev Med Pharmacol Sci 2020; 24: 1350-6. |
| 13. |
Liang C, Wang S, Qin C, et al. TRIM36, a novel androgen-responsive gene, enhances anti-androgen efficacy against prostate cancer by inhibiting MAPK/ERK signaling pathways. Cell Death Dis 2018; 9: 1-13.
DOI URL |
| 14. |
Malik S, Suchal K, Khan SI, et al. Apigenin ameliorates streptozotocin-induced diabetic nephropathy in rats via MAPK-NF-κB-TNF-α and TGF-β1-MAPK-fibronectin pathways. Am J Physiol Renal Physiol 2017; 313: F414-22.
DOI URL |
| 15. |
Wang Q, Zhou C, Zhang D, et al. The involvement of the ERK-MAPK pathway in TGF-β1-mediated connexin43-gap junction formation in chondrocytes. Connect Tissue Res 2019; 60: 477-86.
DOI URL |
| 16. | Lv Z, Xu L. Salvianolic acid B inhibits ERK and p38 MAPK signaling in TGF-1-stimulated human hepatic stellate cell line (LX-2) via distinct pathways. Evid-Based Compl Alt 2012; 4: 960128. |
| 17. | Bein BN, Zdornov EM. Dynamics of spinal cord motor neuron excitability in epileptic patients following surgical elimination of seizures. Vopr Neirokhir 1976; 1976: 40-4. |
| 18. |
Aleksandrovych V, Sajewicz M, Walocha JA, Gil K. Tubal telocytes: factor infertility reason? Folia Med Cracov 2016; 56: 17-23.
PMID |
| 19. |
Witkin SS, Toth M, Jeremias J, Ledger WJ. Increased inducibility of inflammatory mediators from peripheral blood mononuclear cells of women with salpingitis. Am J Obstet Gynecol 1991; 165: 719-23.
PMID |
| 20. | Sikirica V, Bapat B, Candrilli SD, Davis KL, Wilson M, Johns A. The inpatient burden of abdominal and gynecological adhesiolysis in the US. BMC surgery 2011; 11: 13. |
| 21. |
Clement PB. The pathology of endometriosis: a survey of the many faces of a common disease emphasizing diagnostic pitfalls and unusual and newly appreciated aspects. Adv Anat Pathol 2007; 14: 241-60.
PMID |
| 22. |
Wang Q, Usinger W, Nichols B, et al. Cooperative interaction of CTGF and TGF-β in animal models of fibrotic disease. Fibrogenesis Tissue Repair 2011; 4: 4.
DOI URL |
| 23. |
Grotendorst GR. Connective tissue growth factor: a mediator of TGF-β action on fibroblasts. Cytokine Growth Factor Rev 1997; 8: 171-79.
DOI URL |
| 24. |
Li C, Nguyen HT, Zhuang Y, et al. Post-transcriptional up-regulation of miR-21 by type I collagen. Mol Carcinog 2011; 50: 563-70.
DOI URL |
| 25. |
Coulthard LR, White DE, Jones DL, McDermott MF, Burchill SA. p38MAPK: stress responses from molecular mechanisms to therapeutics. Trends Mol Med 2009; 15: 369-79.
DOI PMID |
| 26. |
Alspach E, Flanagan KC, Luo X, et al. p38MAPK plays a crucial role in stromal-mediated tumorigenesis. Cancer Discov 2014; 4: 716-29.
DOI PMID |
| 27. |
Tsukada S, Westwick JK, Ikejima K, Sato N, Rippe RA. SMAD and p38 MAPK signaling pathways independently regulate alpha1(I) collagen gene expression in unstimulated and transforming growth factor-beta-stimulated hepatic stellate cells. J Biol Chem 2005; 280: 10055-64.
DOI URL |
| Viewed | ||||||
|
Full text |
|
|||||
|
Abstract |
|
|||||
