Effect of Tuina along “bladder meridian” alleviating intervertebral disc degeneration by regulating the transforming growth factor-β1/Smad signaling pathway in a rabbit model

doi:10.19852/j.cnki.jtcm.2023.05.005

Abstract

Abstract:

OBJECTIVE: The aim of this study was to investigate the protective effects of Tuina (a traditional Chinese massage therapy) on intervertebral disc (IVD) degeneration and the regulatory mechanisms of the transforming growth factor-β1 (TGF-β1)/small mothers against decapentaplegic (Smad) signaling pathway.
METHODS: Thirty New Zealand white rabbits were randomized into five groups: the control group, model group, model + Tuina group (Tuina group), model + TGF-β1 group (TGF-β1 group), and model + TGF-β1 inhibitor SB431542 group (SB431542 group). The model was established by posterolateral annulus fibrosus puncturing (AFP). Recombinant TGF-β1 and inhibitor SB431542 was injected into the TGF-β1 group and SB431542 group with a microsyringe, respectively. The rabbits in the Tuina group received Tuina treatment along the bladder meridian for 4 weeks. Magnetic resonance imaging (MRI) was performed on rabbits before AFP and after 4 weeks of intervention. Lumbar IVDs (L2-L3 to L4-L5) were harvested after intervention. Histopathological changes in the IVDs were measured by hematoxylin and eosin (HE) staining. Type I collagen was analyzed by immunohistochemistry detection. The expression level of matrix metalloproteinase-3 (MMP3) was determined by enzyme-linked immunosorbent assay. Cell apoptosis was evaluated by terminal deoxynucleotidyl transferase-mediated nick end labeling and Western blotting. Real-time polymerase chain reaction and Western blotting were used to analyze the expression of TGF-β1 and Smad2/3/4 and a disintegrin and metalloproteinase with thrombospondin motifs 5.
RESULTS: Posterolateral AFP induced IVD degeneration in rabbits with histopathological damage and noticeable changes in MRI images. Tuina alleviated histo-pathological changes and reversed the expression of extracellular matrix degeneration-related molecules and apoptosis-related proteins. Furthermore, AFP induced the activation of TGF-β1 and Smad2/3/4, whereas Tuina therapy markedly reduced the protein expression of Smad2/3 and the gene expression of TGF-β1 and Smad2/3/4. Additionally, the TGF-β1/Smad signaling pathway was activated in the TGF-β1 group, while the TGF-β1/Smad signaling pathway was inhibited in the SB431542 group.
CONCLUSION: Posterolateral AFP induced disc degeneration as determined by MRI assessment and histological analysis. Tuina alleviated disc degeneration, possibly by inhibiting the fibrotic response mediated by the TGF-β1/Smad pathway, thus alleviating extracellular matrix degeneration and reducing cell apoptosis.

Key words: intervertebral disc degeneration, transforming growth factor beta1, Smad proteins, Tuina, apoptosis, extracellular matrix degradation

SU Chengguo, ZHAO Xiaoyan, YE Jiangnan, ZHANG Xin, JIANG Yuqing, GUO Junjie, ZHANG Xiyuan, QI Wenchuan, ZHU Jun. Effect of Tuina along “bladder meridian” alleviating intervertebral disc degeneration by regulating the transforming growth factor-β1/Smad signaling pathway in a rabbit model[J]. Journal of Traditional Chinese Medicine, 2023, 43(5): 991-1000.

Figures/Tables 6

Figure 1 The intervertebral disc tissues with hematoxylin and eosin (HE) staining A1, A2: HE staining results of control group; A3, A4: HE staining results of model group; A5, A6: HE staining results of Tuina group. B: Mean histopathological scores. The red arrow shows a disorganized and ruptured annulus fibrosus; the black arrow indicates greatly reduced nucleus pulposus cells; the yellow arrow shows relatively few wavy fibrocartilage lamellas; and the blue arrow indicates a slight decrease in the number of cells in the nucleus pulposus. Rabbits in the control group underwent sham surgerie. The IVD degeneration model was established in all groups except for the control group. Rabbits in the model group underwent surgeries of posterolateral annulus fibrosus puncturing (AFP). Rabbits in the Tuina group were treated with Tuina along the bladder meridian for 4 weeks. IVD: intervertebral disc. The data are shown as the mean ± standard deviation (n = 6). aP < 0.05 vs the control group; bP < 0.05 vs the model group.

Table 1 Histological grading scale

Items	Degeneration grade
I. Anulus fibrosus	1. Normal pattern of fibrocartilage lamellae
	2. Slightly ruptured or irregularly-shaped fibers
	3. Moderately/severely ruptured or irregularly shaped fibers
II. Border between the anulus fibrosus and nucleus pulposus	1. Normal
	2. Slight interruption
	3. Moderate or severe interruption
III. Cells of the nucleus pulposus	1. Abundant cells
	2. Slight decrease in cell count
	3. Moderate or severe decrease in cell count
IV. Matrix of the nucleus pulposus	1. Normal gelatinous appearance
	2. Slight condensation of the matrix
	3. Moderate or severe condensation of the matrix

Table 2 Primers for target genes

Gene	Forward (5′-3′)	Reverse (5′-3′)
GAPDH	GTTCCACGGCACGGTCAAGG	CGTACTCGGCACCAGCATCAC
ADAMTS5	GCCAGCATCGAGAACCACATCC	TGCTCACCTCCAGGCTCTTGTC
TGF-β1	GGAACGGGCTCAACATCTACACAG	CCAGGTCCTTGCGGAAGTCAATG
Smad2	ATGTCGTCCATCTTGCCGTTCAC	GCCTTCTCACACCACTTCTCTTCC
Smad3	TGTCGTCCATCCTGCCCTTCAC	ACTTCTCCTCCTGCCCGTTCTG
Smad4	CAGCCAGGACAGCAGCAGAATG	TGGTGGTGAGGCAAATTAGGTGTG

Figure 2 The expression of COL I, MMP3 and ADAMTS5 A1: Immunofluorescence staining for COL I of control group; A2: Immunofluorescence staining for COL I of model group; A3: Immunofluorescence staining for COL I of Tuina group. B: The average optical density of COL I was analyzed by Image-Pro Plus 6.0 software (n = 6). C: The concentration of MMP3 in the intervertebral disc was determined by ELISA (n = 6). D: ADAMTS5 gene expression was analyzed by real-time PCR (n = 6). E, F: The protein expression of ADAMTS5 (n = 6). Rabbits in the control group underwent sham surgeries.The IVD degeneration model was established in all groups except for the control group. Rabbits in the model group underwent surgeries of posterolateral annulus fibrosus puncturing (AFP). Rabbits in the Tuina group were treated with Tuina along the bladder meridian for 4 weeks. aP < 0.05 vs the control group; bP < 0.05 vs the model group.

Figure 3 Cell apoptosis in intervertebral discs A1-A3: terminal deoxynucleotidyl transferase-mediated nick end labeling (TUNEL) staining of control group; A4-A6: TUNEL staining of model group; A7-A9: TUNEL staining of model group. B: The number of TUNEL-positive cells (n = 6); C, D: the protein expression of Bax, caspase-3 and Bcl-2 (n = 6). The red arrow shows TUNEL-positive cells. Rabbits in the control group underwent sham surgeries. The IVD degeneration model was established in all groups except for the control group. Rabbits in the model group underwent surgeries of posterolateral annulus fibrosus puncturing (AFP). Rabbits in the Tuina group were treated with Tuina along the bladder meridian for 4 weeks. IVD: intervertebral disc. aP < 0.05 vs the control group; bP < 0.05 vs the model group.

Figure 4 Expression of the TGF-β1/Smad pathway A: the gene expression of TGF-β1, Smad2, Smad3, and Smad4 analyzed by real-time PCR (n = 6). B, C: the protein expression of TGF-β1, Smad2, Smad3, and Smad4 detected by Western blotting (n = 6). Rabbits in the control group underwent sham surgeries. The IVD degeneration model was established in all groups except for the control group. Rabbits in the model group underwent surgeries of posterolateral annulus fibrosus puncturing (AFP). Rabbits in the Tuina group were treated with Tuina along the bladder meridian for 4 weeks. Rabbits in the TGF-β1 group was injected with Recombinant TGF-β1 into the center of each IVD; while the TGF-β1 inhibitor SB431542 was injected into the SB431542 group. aP < 0.05 vs the control group; bP < 0.05 vs the model group.

References 61.

1.	Ma K, Chen S, Li Z, et al. Mechanisms of endogenous repair failure during intervertebral disc degeneration. Osteoarthritis Cartilage 2019; 27: 41-8. DOI URL
2.	Vo NV, Hartman RA, Yurube T, Jacobs LJ, Sowa GA, Kang JD. Expression and regulation of metalloproteinases and their inhibitors in intervertebral disc aging and degeneration. Spine J 2013; 13: 331-41. DOI PMID
3.	Liu H, Kang H, Song C, et al. Urolithin a inhibits the catabolic effect of tnfα on nucleus pulposus cell and alleviates intervertebral disc degeneration in vivo. Front Pharmacol 2018; 9: 1043. DOI URL
4.	Molinos M, Almeida CR, Caldeira J, Cunha C, Gonçalves RM, Barbosa MA. Inflammation in intervertebral disc degeneration and regeneration. J R Soc Interface 2015; 12: 20150429. DOI URL
5.	Henry N, Clouet J, Le Bideau J, Le Visage C, Guicheux J. Innovative strategies for intervertebral disc regenerative medicine: From cell therapies to multiscale delivery systems. Biotechnol Adv 2018; 36: 281-94. DOI PMID
6.	Fontana G, See E, Pandit A. Current trends in biologics delivery to restore intervertebral disc anabolism. Adv Drug Deliv Rev 2015; 84: 146-58. DOI URL
7.	Juch J, Maas ET, Ostelo R, et al. Effect of radiofrequency denervation on pain intensity among patients with chronic low back pain: the mint randomized clinical trials. JAMA 2017; 318: 68-81. DOI PMID
8.	Frapin L, Clouet J, Delplace V, Fusellier M, Guicheux J, Le Visage C. Lessons learned from intervertebral disc pathophysiology to guide rational design of sequential delivery systems for therapeutic biological factors. Adv Drug Deliv Rev 2019; 149-50: 49-71.
9.	Chen X, Zhu L, Wu G, Liang Z, Yang L, Du Z. A comparison between nucleus pulposus-derived stem cell transplantation and nucleus pulposus cell transplantation for the treatment of intervertebral disc degeneration in a rabbit model. Int J Surg 2016; 28: 77-82. DOI PMID
10.	Lund T, Oxland TR. Adjacent level disk disease-is it really a fusion disease? Orthop Clin North Am 2011; 42: 529-41. DOI URL
11.	Mo Z, Li D, Zhang R, Chang M, Yang B, Tang S. Comparisons of the effectiveness and safety of Tuina, acupuncture, traction, and chinese herbs for lumbar disc herniation: a systematic review and network Meta-analysis. Evid Based Complement Alternat Med 2019; 2019: 6821310.
12.	Furlan AD, Giraldo M, Baskwill A, Irvin E, Imamura M. Massage for low-back pain. Cochrane Database Syst Rev 2015; 2015: D1929.
13.	Miao Z, Tong Z, Ye J, et al. Tuina for lumbar disc herniation: a protocol for systematic review and Meta-analysis. Medicine (Baltimore) 2021; 100: e24203. DOI URL
14.	Huang LS, Huang PP, Tong XB, Li ZL, Fang YP, Liao J. Effects of chiropractics on intervertebral disk extracell matrix and metabolic enzymes in rats with cervical spondylosis. Zhen Ci Yan Jiu 2017; 42: 321-6.
15.	Shu J, Li D, Tao W, Chen S. Observation on the curative effect of massage manipulation combined with core strength training in patients with chronic nonspecific low back pain. Evid Based Complement Alternat Med 2021; 2021: 7534577.
16.	Won ES, Lee H, Kang JH. Effectiveness and safety assessment of orthopedic device (LSM-01) for low back pain: a randomized, single-blinded, sham-controlled, parallel-group, pilot clinical trial. Medicine (Baltimore) 2022; 101: e28527. DOI URL
17.	Tan H, Tumilty S, Chapple C, Liu L, Othman R, Baxter GD. Acupoints sensitization in people with and without chronic low back pain: a matched-sample cross-sectional study. J Back Musculoskelet Rehabil 2023; 36: 137-46.
18.	Goo B, Kim JH, Kim EJ, et al. Thread embedding acupuncture for herniated intervertebral disc of the lumbar spine: a multicenter, randomized, patient-assessor-blinded, controlled, parallel, clinical trial. Complement Ther Clin Pract 2022; 46: 101538. DOI URL
19.	Ding F, Shao ZW, Xiong LM. Cell death in intervertebral disc degeneration. Apoptosis 2013; 18: 777-85. DOI PMID
20.	Feng G, Zha Z, Huang Y, et al. Sustained and bioresponsive two-stage delivery of therapeutic mirna via polyplex micelle-loaded injectable hydrogels for inhibition of intervertebral disc fibrosis. Adv Healthc Mater 2018; 7: e1800623.
21.	Chen S, Liu S, Ma K, Zhao L, Lin H, Shao Z. TGF-β signaling in intervertebral disc health and disease. Osteoarthritis Cartilage Online 2019; 27: 1109-17.
22.	Jin H, Shen J, Wang B, Wang M, Shu B, Chen D. TGF-β signaling plays an essential role in the growth and maintenance of intervertebral disc tissue. FEBS Lett 2011; 585: 1209-15. DOI PMID
23.	Zieba J, Forlenza KN, Khatra JS, et al. TGFβ and BMP dependent cell fate changes due to loss of filamin b produces disc degeneration and progressive vertebral fusions. PLoS Genet 2016; 12: e1005936. DOI URL
24.	Tian Y, Yuan W, Li J, et al. TGFβ regulates Galectin-3 expression through canonical Smad3 signaling pathway in nucleus pulposus cells: implications in intervertebral disc degeneration. Matrix Biol 2016; 50: 39-52. DOI PMID
25.	Kim KK, Sheppard D, Chapman HA. TGF-β1 signaling and tissue fibrosis. Cold Spring Harb Perspect Biol 2018; 10: a022293. DOI URL
26.	Xu Y, Qu X, Zhou J, et al. Pilose antler peptide-3.2KD ameliorates adriamycin-induced myocardial injury through TGF-β/SMAD signaling pathway. Front Cardiovasc Med 2021; 8: 659643. DOI URL
27.	Bian Q, Ma L, Jain A, et al. Mechanosignaling activation of TGFβ maintains intervertebral disc homeostasis. Bone Res 2017; 5: 17008. DOI PMID
28.	Meng XM, Nikolic-Paterson DJ, Lan HY. TGF-β: the master regulator of fibrosis. Nat Rev Nephrol 2016; 12: 325-38. DOI
29.	Masuda K, Aota Y, Muehleman C, et al. A novel rabbit model of mild, reproducible disc degeneration by an anulus needle puncture: correlation between the degree of disc injury and radiological and histological appearances of disc degeneration. Spine (Phila Pa 1976) 2005; 30: 5-14. DOI URL
30.	Yang H, Cao C, Wu C, et al. TGF-βl suppresses inflammation in cell therapy for intervertebral disc degeneration. Sci Rep 2015; 5: 13254. DOI PMID
31.	Wang WJ, Yu XH, Wang C, et al. MMPs and ADAMTSs in intervertebral disc degeneration. Clin Chim Acta 2015; 448: 238-46. DOI URL
32.	Livshits G, Popham M, Malkin I, et al. Lumbar disc degeneration and genetic factors are the main risk factors for low back pain in women: the UK Twin Spine Study. Ann Rheum Dis 2011; 70: 1740-5. DOI PMID
33.	Takatalo J, Karppinen J, Niinimäki J, et al. Does lumbar disc degeneration on magnetic resonance imaging associate with low back symptom severity in young Finnish adults? Spine (Phila Pa 1976) 2011; 36: 2180-9. DOI URL
34.	Feng C, Yang M, Lan M, et al. ROS: Crucial intermediators in the pathogenesis of intervertebral disc degeneration. Oxid Med Cell Longev 2017; 2017: 5601593.
35.	Yao C, Guo G, Huang R, et al. Manual therapy regulates oxidative stress in aging rat lumbar intervertebral discs through the SIRT1/FOXO1 pathway. Aging (Albany NY) 2022; 14: 2400-17.
36.	Sudhir G, Jayabalan V, Sellayee S, Gadde S, Kailash K. Is there an interdependence between paraspinal muscle mass and lumbar disc degeneration? A MRI based study at 2520 levels in 504 patients. J Clin Orthop Trauma 2021; 22: 101576.
37.	Kader DF, Wardlaw D, Smith FW. Correlation between the MRI changes in the lumbar multifidus muscles and leg pain. Clin Radiol 2000; 55: 145-9. DOI PMID
38.	Zhu F, Duan W, Zhong C, Ji B, Liu X. The protective effects of dezocine on interleukin-1β-induced inflammation, oxidative stress and apoptosis of human nucleus pulposus cells and the possible mechanisms. Bioengineered 2022; 13: 1399-410. DOI PMID
39.	Freemont AJ. The cellular pathobiology of the degenerate intervertebral disc and discogenic back pain. Rheumatology (Oxford) 2009; 48: 5-10. DOI PMID
40.	Le Maitre CL, Pockert A, Buttle DJ, Freemont AJ, Hoyland JA. Matrix synthesis and degradation in human intervertebral disc degeneration. Biochem Soc Trans 2007; 35: 652-5. DOI URL
41.	Antoniou J, Goudsouzian NM, Heathfield TF, et al. The human lumbar endplate. Evidence of changes in biosynthesis and denaturation of the extracellular matrix with growth, maturation, aging, and degeneration. Spine (Phila Pa 1976) 1996; 21: 1153-61. DOI URL
42.	Kong M, Zhang Y, Song M, et al. Myocardin-related transcription factor a nuclear translocation contributes to mechanical overload-induced nucleus pulposus fibrosis in rats with intervertebral disc degeneration. Int J Mol Med 2021; 48.
43.	Che Z, Xueqin J, Zhang Z. LncRNA OIP5-AS1 accelerates intervertebral disc degeneration by targeting miR-25-3p. Bioengineered 2021; 12: 11201-12. DOI PMID
44.	Le Maitre CL, Freemont AJ, Hoyland JA. Localization of degradative enzymes and their inhibitors in the degenerate human intervertebral disc. J Pathol 2004; 204: 47-54. DOI PMID
45.	Bachmeier BE, Nerlich A, Mittermaier N, et al. Matrix metalloproteinase expression levels suggest distinct enzyme roles during lumbar disc herniation and degeneration. Eur Spine J 2009; 18: 1573-86. DOI PMID
46.	Zhao K, Chen M, Liu T, et al. Rhizoma drynariae total flavonoids inhibit the inflammatory response and matrix degeneration via MAPK pathway in a rat degenerative cervical intervertebral disc model. Biomed Pharmacother 2021; 138: 111466. DOI PMID
47.	Wei F, Zhong R, Zhou Z, et al. In vivo experimental intervertebral disc degeneration induced by bleomycin in the rhesus monkey. BMC Musculoskelet Disord 2014; 15: 340. DOI URL
48.	Zhao CQ, Jiang LS, Dai LY. Programmed cell death in intervertebral disc degeneration. Apoptosis 2006; 11: 2079-88. DOI URL
49.	Li D, Zhu B, Ding L, Lu W, Xu G, Wu J. Role of the mitochondrial pathway in serum deprivation-induced apoptosis of rat endplate cells. Biochem Biophys Res Commun 2014; 452: 354-60. DOI URL
50.	Tu J, Li W, Zhang Y, et al. Simvastatin inhibits IL-1β-induced apoptosis and extracellular matrix degradation by suppressing the NF-kB and MAPK pathways in nucleus pulposus cells. Inflammation 2017; 40: 725-34. DOI PMID
51.	Gruber HE, Hoelscher GL, Ingram JA, Bethea S, Zinchenko N, Hanley EJ. Variations in aggrecan localization and gene expression patterns characterize increasing stages of human intervertebral disk degeneration. Exp Mol Pathol 2011; 91: 534-9. DOI PMID
52.	Peng B, Hao J, Hou S, et al. Possible pathogenesis of painful intervertebral disc degeneration. Spine (Phila Pa 1976) 2006; 31: 560-6. DOI URL
53.	Bian Q, Jain A, Xu X, et al. Excessive activation of TGFβ by spinal instability causes vertebral endplate sclerosis. Sci Rep 2016; 6: 27093. DOI PMID
54.	Qin Z, Xia W, Fisher GJ, Voorhees JJ, Quan T. YAP/TAZ regulates TGF-β/Smad3 signaling by induction of Smad7 via AP-1 in human skin dermal fibroblasts. Cell Commun Signal 2018; 16: 18. DOI
55.	Heldin CH, Moustakas A. Role of Smads in TGFβ signaling. Cell Tissue Res 2012; 347: 21-36. DOI URL
56.	Moustakas A, Heldin CH. The regulation of TGFbeta signal transduction. Development 2009; 136: 3699-714. DOI PMID
57.	He W, Li AG, Wang D, et al. Overexpression of Smad7 results in severe pathological alterations in multiple epithelial tissues. Embo J 2002; 21: 2580-90. DOI PMID
58.	Hu HH, Chen DQ, Wang YN, et al. New insights into TGF-β/Smad signaling in tissue fibrosis. Chem Biol Interact 2018; 292: 76-83. DOI URL
59.	Chen SJ, Ning H, Ishida W, et al. The early-immediate gene EGR-1 is induced by transforming growth factor-beta and mediates stimulation of collagen gene expression. J Biol Chem 2006; 281: 21183-97. DOI URL
60.	Ghosh AK, Yuan W, Mori Y, Varga J. Smad-dependent stimulation of type I collagen gene expression in human skin fibroblasts by TGF-beta involves functional cooperation with p300/CBP transcriptional coactivators. Oncogene 2000; 19: 3546-55. DOI PMID
61.	Yang H, Yuan C, Wu C, et al. The role of TGF-β1/Smad2/3 pathway in platelet-rich plasma in retarding intervertebral disc degeneration. J Cell Mol Med 2016; 20: 1542-9. DOI PMID

[1]	LI Xi, LIN Xiangquan, CHEN Dongdong, LIU Hui. B-cell lymphoma-2 phosphorylation at Ser70 site-related autophagy mediates puerarin-inhibited the apoptosis of MC3T3-E1 cells during osteoblastogenesis [J]. Journal of Traditional Chinese Medicine, 2024, 44(1): 27-34.
[2]	ZHUANG Xingxing, LIU Tao, WEI Liangbing, SONG Junmei, GAO Jiarong. Qiteng Xiaozhuo granules (芪藤消浊颗粒) medicated serum inhibits excessive proliferation and promotes apoptosis of human glomerular mesangial cells by targeting fat mass and obesity associated proteins [J]. Journal of Traditional Chinese Medicine, 2023, 43(6): 1072-1080.
[3]	WANG Miao, ZHU Yan, ZHAO Hui, ZHAO Hongfang. Moxibustion enables protective effects on rheumatoid arthritis-induced myocardial injury via transforming growth factor beta1 signaling and metabolic reprogramming [J]. Journal of Traditional Chinese Medicine, 2023, 43(6): 1190-1199.
[4]	ZHU Bin, YU Ning, WANG Lei, TIAN Yue, WU Mingfen, ZHAO Zhigang. Synergistic effect of schizandrin A and DNase I knockdown on high glucose induced beta cell apoptosis by decreasing intracellular calcium concentration [J]. Journal of Traditional Chinese Medicine, 2023, 43(4): 661-666.
[5]	HUANG Hongye, WANG Bingqian, CHEN Shuijin, FANG Jiayu, WANG Xiaohua, CHEN Lechun, JIANG Yu, ZHANG Huanzhen, CHEN Jincheng, LIN Zhigang. Chinese Tuina remodels the synaptic structure in neuropathic pain rats by downregulating the expression of N-methyl D-aspartate receptor subtype 2B and postsynaptic density protein-95 in the spinal cord dorsal horn [J]. Journal of Traditional Chinese Medicine, 2023, 43(4): 715-724.
[6]	LIU Di, ZHANG Yingqi, YU Tianyuan, LIU Zhifeng, JIAO Yi, WANG Hourong, XU Yajing, GUAN Qian, CHEN Lulu, HU Hui. Protective mechanisms of Tuina therapy against lipopolysaccharide-induced fever in young rabbits based on untargeted metabolomics analysis [J]. Journal of Traditional Chinese Medicine, 2023, 43(4): 725-733.
[7]	WAN Feng, YANG Ruchun, TANG Yuewen. Uncovering pharmacological mechanisms of Phellinus linteus on focal segmental glomeruloscleosis rats through tandem mass tag-based quantitative proteomic analysis, network pharmacology analysis and experimental validation [J]. Journal of Traditional Chinese Medicine, 2023, 43(4): 744-750.
[8]	JIANG Yiqian, ZHOU Xibin, PU Wenyuan, ZHOU Chunxiang. Sanwu Baisan decoction (三物白散) inhibits colorectal cancer progression in mice by remodeling gut microbiota and tumorigenesis [J]. Journal of Traditional Chinese Medicine, 2023, 43(3): 466-473.
[9]	WANG Tianqi, LI Zining, CHEN Ting, CHEN Rui, JIN Ya, Oduro Patrick kwabena, ZHANG Han, WANG Yi. Zuogui (左归丸) and Yougui pills (右归丸) improve perimenopausal syndrome via regulation of apoptosis in mice [J]. Journal of Traditional Chinese Medicine, 2023, 43(3): 474-483.
[10]	ZHAO Ye, WANG Xian, GU Ling, LI Zihang, ZHU Jingtian, WANG Wenkai, ZHANG Liang, XUE Mei. Efficacy of Danggui Buxue decoction (当归补血汤) on diabetic nephropathy-induced renal fibrosis in rats and possible mechanism [J]. Journal of Traditional Chinese Medicine, 2023, 43(3): 507-513.
[11]	XIE Jing, BI Zheng, WANG Sihai, SHEN Guoming, FANG Zhaohui. Danzhi Jiangtang capsule (丹蛭降糖胶囊) reduces renal injury in rats with diabetes induced by high fat diet and streptozotocin via downregulating toll-like receptor 4-nuclear factor-κB pathway and apoptosis [J]. Journal of Traditional Chinese Medicine, 2023, 43(2): 312-321.
[12]	DING Yajie, LIU Feng, LI Zhaoyan, Xu Yan, CAO Nida, ZHANG Guangao, WANG Rui, ZHAO Aiguang. Efficacy of luteolin on the human gastric cancer cell line MKN45 and underlying mechanism [J]. Journal of Traditional Chinese Medicine, 2023, 43(1): 34-41.
[13]	JIANG Wen, ZHANG Wei, ZHANG Yuxiang, YANG Hao, PAN Xiaomei, CHEN Qiang, CHEN Junhui. Tilianin extracted from Xiangqinglan (Herba Dracocephali Moldovicae) inhibits apoptosis induced by mitochondrial pathway and endoplasmic reticulum stress in H9c2 cells after oxygen-glucose deprivation/reoxygenation [J]. Journal of Traditional Chinese Medicine, 2023, 43(1): 42-50.
[14]	YANG Ye, ZHANG Aihui, LI Anmao. Celastrol promotes apoptotic cell death in children neuroblastoma cells through caspases dependent pathway [J]. Journal of Traditional Chinese Medicine, 2022, 42(6): 877-884.
[15]	ZHENG Wei, WANG Mingxing, LIU Shanxue, LUAN Chao, ZHANG Yanqiu, XU Duoduo, WANG Jian. Buyang Huanwu Tang (补阳还五汤) protects H₂O₂-induced RGC-5 cell against oxidative stress and apoptosis via reactive oxygen species-mitogen-activated protein kinase signaling pathway [J]. Journal of Traditional Chinese Medicine, 2022, 42(6): 885-891.

Home

Online First

Author Center

Reviewer Center

Issues

Announcement

About Us