Journal of Traditional Chinese Medicine ›› 2023, Vol. 43 ›› Issue (6): 1140-1149.DOI: 10.19852/j.cnki.jtcm.20221230.001
• Research Articles • Previous Articles Next Articles
SHI Xiao1, WANG Lina2, HU Jianpeng1(), ZHANG Limiao1, WANG Jin1
Received:
2022-06-11
Accepted:
2022-09-27
Online:
2023-10-25
Published:
2022-12-30
Contact:
Prof. HU Jianpeng, Department of Graduate school, Anhui University of Chinese Medicine, Hefei 230012, China. hujianpeng351@126.com. Telephone: +86-13739292867
Supported by:
SHI Xiao, WANG Lina, HU Jianpeng, ZHANG Limiao, WANG Jin. Effect of Naoluoxintong formula (脑络欣通方) and its split prescriptions on cerebral vascular regeneration in rats with the cerebral ischemia-reperfusion[J]. Journal of Traditional Chinese Medicine, 2023, 43(6): 1140-1149.
Neurological deficit | Score (points) |
---|---|
No neurological impairment | 0 |
cannot extend the contralateral forepaw | 1 |
Turn outward | 2 |
Dump to the opposite side | 3 |
Inability to walk spontaneously, loss of consciousness | 4 |
Table 1 Zea-longa (0-4 points) scoring criteria
Neurological deficit | Score (points) |
---|---|
No neurological impairment | 0 |
cannot extend the contralateral forepaw | 1 |
Turn outward | 2 |
Dump to the opposite side | 3 |
Inability to walk spontaneously, loss of consciousness | 4 |
Qi deficiency symptom | |
---|---|
Mental fatigue, poor mobility; hair withered; no appetite, mild loose stool | 3 points each |
Lethargy; hair fringe; moderate loose stool | 5 points each |
Poor or absent antagonistic behavior; hair is sparse and easy to fall; severe loose stool with yellow-green smelly poop | 7 points each |
Table 2 Syndrome differentiation scale of Qi deficiency syndrome in rats
Qi deficiency symptom | |
---|---|
Mental fatigue, poor mobility; hair withered; no appetite, mild loose stool | 3 points each |
Lethargy; hair fringe; moderate loose stool | 5 points each |
Poor or absent antagonistic behavior; hair is sparse and easy to fall; severe loose stool with yellow-green smelly poop | 7 points each |
Blood stasis syndrome | |
---|---|
Bleak tongue; eyeball turns pale red; the color of rat tail is dim | 3 points each |
Purple tongue; eyeball turns dark red; mouse tail slightly purple with blood stasis | 5 points each |
Table 3 Syndrome differentiation scale of blood stasis syndrome in rats
Blood stasis syndrome | |
---|---|
Bleak tongue; eyeball turns pale red; the color of rat tail is dim | 3 points each |
Purple tongue; eyeball turns dark red; mouse tail slightly purple with blood stasis | 5 points each |
Group | Model success rate | Mortality rate |
---|---|---|
S | 100 | 0 |
M | 88.89 | 11.11 |
NMDP | 94.44 | 5.56 |
NLXT | 94.44 | 5.56 |
YQ | 94.44 | 5.56 |
HXTL | 88.89 | 11.11 |
Table 4 Table of success rate and death rate of models in each group (%)
Group | Model success rate | Mortality rate |
---|---|---|
S | 100 | 0 |
M | 88.89 | 11.11 |
NMDP | 94.44 | 5.56 |
NLXT | 94.44 | 5.56 |
YQ | 94.44 | 5.56 |
HXTL | 88.89 | 11.11 |
Gene | Amplicon size (bp) | Forward (5'→3') | Reverse (5'→3') |
---|---|---|---|
β-actin | 150 | CCCATCTATGAGGGTTACGC | TTTAATGTCACGCACGATTTC |
Ang-1 | 169 | ATGCCAGATACTGCGAAAGT | GTGATCTGGAAGGGAGACTG |
Ang-2 | 133 | GAACTTGCTGCATCCAAAGAT | CTAAGTGATGTGCGTCAGTC |
Table 5 Quantitative polymerase chain reaction primer sequence
Gene | Amplicon size (bp) | Forward (5'→3') | Reverse (5'→3') |
---|---|---|---|
β-actin | 150 | CCCATCTATGAGGGTTACGC | TTTAATGTCACGCACGATTTC |
Ang-1 | 169 | ATGCCAGATACTGCGAAAGT | GTGATCTGGAAGGGAGACTG |
Ang-2 | 133 | GAACTTGCTGCATCCAAAGAT | CTAAGTGATGTGCGTCAGTC |
Group | n | Neurological deficit score (points) | Qi deficiency score (points) | Blood stasis score (points) |
---|---|---|---|---|
S | 18 | 0.0±0.0 | 3.4±1.2 | 3.8±1.4 |
M | 18 | 2.6±0.5a | 13.4±2.6a | 13.8±2.5a |
NMDP | 18 | 0.4±0.5b | 4.6±1.6b | 5.2±2.4b |
NLXT | 18 | 0.6±0.5b | 5.4±2.3b | 6.4±2.1b |
HXTL | 18 | 1.7±0.7bc | 10.1±1.8bc | 11.1±2.2bc |
YQ | 18 | 1.7±0.6bc | 10.3±1.6bc | 11.2±2.0bc |
Table 6 Effect of Naoluoxintong and its split prescriptions on the neurological deficit score, Qi deficiency score, and blood stasis score of the experimental rats (
Group | n | Neurological deficit score (points) | Qi deficiency score (points) | Blood stasis score (points) |
---|---|---|---|---|
S | 18 | 0.0±0.0 | 3.4±1.2 | 3.8±1.4 |
M | 18 | 2.6±0.5a | 13.4±2.6a | 13.8±2.5a |
NMDP | 18 | 0.4±0.5b | 4.6±1.6b | 5.2±2.4b |
NLXT | 18 | 0.6±0.5b | 5.4±2.3b | 6.4±2.1b |
HXTL | 18 | 1.7±0.7bc | 10.1±1.8bc | 11.1±2.2bc |
YQ | 18 | 1.7±0.6bc | 10.3±1.6bc | 11.2±2.0bc |
Figure 1 Effect of Naoluoxintong and its split prescriptions on the morphology of the cerebral cortex of ischemic frontal cortex in the experimental rats (hematoxylin and eosin staining, × 400, n = 6) A-F: typical image showing pathological sections. A: Shame group (saline, 14 d); B: Model group (saline, 14 d); C: Nimodiping group (8.1 mg/kg, 14 d); D: Naoluoxintong group (7.2 g/kg, 14 d); E: Yiqi group (2.7 g/kg, 14 d); F: Huoxuetongluo group (4.5 mg/kg, 14 d). Red arrows show degenerated and necrotic nerve cells.
Group | n | Cerebral infarction area | VEGFA | VEGFR2 | CD31 |
---|---|---|---|---|---|
S | 6 | 0.00±0.00 | 16.33±1.21 | 11.83±1.17 | 2.18±0.11 |
M | 6 | 25.77±1.36a | 18.50±1.38 | 15.5±1.05 | 5.83±0.30a |
NMDP | 6 | 12.38±1.10b | 39.50±3.62b | 37.17±2.32b | 19.14±1.91b |
NLXT | 6 | 13.80±1.63b | 39.17±2.79b | 35.83±2.32b | 19.63±0.44b |
YQ | 6 | 23.31±0.84c | 21.50±1.87b | 21.17±1.94bc | 13.80±0.92bc |
HXTL | 6 | 21.45±1.60bc | 23.17±1.48bc | 23.17±1.47bc | 11.95±0.43bc |
Table 7 Effect of Naoluoxintong and its split prescriptions on the cerebral infarction area in the experimental rats (
Group | n | Cerebral infarction area | VEGFA | VEGFR2 | CD31 |
---|---|---|---|---|---|
S | 6 | 0.00±0.00 | 16.33±1.21 | 11.83±1.17 | 2.18±0.11 |
M | 6 | 25.77±1.36a | 18.50±1.38 | 15.5±1.05 | 5.83±0.30a |
NMDP | 6 | 12.38±1.10b | 39.50±3.62b | 37.17±2.32b | 19.14±1.91b |
NLXT | 6 | 13.80±1.63b | 39.17±2.79b | 35.83±2.32b | 19.63±0.44b |
YQ | 6 | 23.31±0.84c | 21.50±1.87b | 21.17±1.94bc | 13.80±0.92bc |
HXTL | 6 | 21.45±1.60bc | 23.17±1.48bc | 23.17±1.47bc | 11.95±0.43bc |
Figure 2 Effect of Naoluoxintong and its split prescriptions on the ultrastructure of blood vessels in ischemic frontal cortex of experimental rats (glutaraldehyde staining, × 25 000, n = 6) A-F: typical image showing pathological sections. A: Shame group (saline, 14 d); B: Model group (saline, 14 d); C: Nimodiping group (8.1 mg/kg, 14 d); D: Naoluoxintong group (7.2 g/kg, 14 d); E: Yiqi group (2.7 g/kg, 14 d); F: Huoxuetongluo group (4.5 mg/kg, 14 d).
Figure 3 Effect of Naoluoxintong and its split prescriptions on the VEGFA, VEGFR2 and CD31 protein expression within frontoparietal cortex in the experimental rats (immunofluorescence staining, × 400, n = 6) A/B/C: representative images of a histological section of VEGFA/ VEGFR2/CD31; A1, A2, and A3 are VEGFA/VEGFR2, DAPI, and Merge, respectively, in the sham group (saline, 14 d); B1, B2 and B3 were VEGFA/VEGFR2/CD31, DAPI, and Merge, respectively, in the model group (saline, 14 d); C1, C2 and C3 were VEGFA/VEGFR2/CD31, DAPI, and Merge, respectively, in the Nimodiping group (8.1 mg/kg, 14 d); D1, D2 and D3 were VEGFA/VEGFR2/CD31, DAPI, and Merge, respectively, in the Naoluoxintong group (7.2 g/kg, 14 d); E1, E2 and E3 were VEGFA/VEGFR2/CD31, DAPI, and Merge, respectively, in the Yiqi group (2.7 g/kg, 14 d). F1, F2 and F3 VEGFA/VEGFR2, DAPI, and Merge, respectively, in the Huoxuetongluo group (4.5 mg/kg, 14 d). VEGFA: vascular endothelial growth factor A; VEGFR2: vascular endothelial growth factor receptor 2; CD31: platelet endothelial cell adhesion molecule-1.
Figure 4 Effect of Naoluoxintong and its split prescriptions on the protein levels of Tie2 and p38 MAPK in the frontoparietal cortex of the experimental rats A: Shame group (saline, 14 d); B: Model group (saline, 14 d); C: Nimodiping group (8.1 mg/kg, 14 d); D: Naoluoxintong group (7.2 g/kg, 14 d); E: Yiqi group (2.7 g/kg, 14 d); F: Huoxuetongluo group (4.5 mg/kg, 14 d). GAPDH: glyceraldehyde-3-phosphate dehydrogenase; Tie2: angiopoietin receptor 2; P38MAPK: P38 mitogen-activated protein kinase.
Group | n | p38MAPK | Tie2 | Ang1 | Ang2 |
---|---|---|---|---|---|
S | 6 | 0.290±0.084 | 0.220±0.081 | 1.004±0.103 | 1.010±0.146 |
M | 6 | 0.913±0.118a | 0.420±0.119a | 1.322±0.131a | 1.646±0.226a |
NMDP | 6 | 0.398±0.052b | 0.839±0.134b | 2.392±0.406b | 3.692±0.691b |
NLXT | 6 | 0.450±0.016b | 0.896±0.111b | 2.226±0.220b | 3.421±0.371b |
YQ | 6 | 0.727±0.080bc | 0.675±0.068bc | 1.569±0.072bc | 2.151±0.216bc |
HXTL | 6 | 0.767±0.116bc | 0.642±0.122bc | 1.814±0.078bc | 2.531±0.402bc |
Table 8 Effect of Naoluoxintong and its split prescriptions on P38MAPK, Tie2, Ang1 and Ang2 protein levels in the frontoparietal cortex of the experimental rats (
Group | n | p38MAPK | Tie2 | Ang1 | Ang2 |
---|---|---|---|---|---|
S | 6 | 0.290±0.084 | 0.220±0.081 | 1.004±0.103 | 1.010±0.146 |
M | 6 | 0.913±0.118a | 0.420±0.119a | 1.322±0.131a | 1.646±0.226a |
NMDP | 6 | 0.398±0.052b | 0.839±0.134b | 2.392±0.406b | 3.692±0.691b |
NLXT | 6 | 0.450±0.016b | 0.896±0.111b | 2.226±0.220b | 3.421±0.371b |
YQ | 6 | 0.727±0.080bc | 0.675±0.068bc | 1.569±0.072bc | 2.151±0.216bc |
HXTL | 6 | 0.767±0.116bc | 0.642±0.122bc | 1.814±0.078bc | 2.531±0.402bc |
1. |
Putaala J. Ischemic stroke in young adults. Continuum (Minneap Minn) 2020; 26: 386-414.
DOI PMID |
2. |
Davis SM, Donnan GA. 4.5 hours: the new time window for tissue plasminogen activator in stroke. Stroke 2009; 40: 2266-7.
DOI PMID |
3. | Liang H, Xiao J, Zhou Z, et al. Hypoxia induces miR-153 through the IRE1α-XBP 1 pathway to fine tune the HIF1α/VEGFA axis in breast cancer angiogenesis. Oncogene 2018; 37: 1961-975. |
4. |
Zhao J, Du P, Cui P, et al. LncRNA PVT1 promotes angiogenesis via activating the STAT3/VEGFA axis in gastric cancer. Oncogene 2018; 37: 4094-109.
DOI |
5. |
Hong S, Chen S, Wang X, et al. ATAD2 silencing decreases VEGFA secretion through targeting has-miR-520a to inhibit angiogenesis in colorectal cancer. Biochem Cell Biol 2018; 96: 761-68.
DOI PMID |
6. |
Claesson-Welsh L, Welsh M. VEGFA and tumor angiogenesis. J Intern Med 2013; 273: 114-27.
DOI PMID |
7. |
Sung JF, Fan X, Dhal S, et al. Decreased circulating soluble Tie2 levels in preeclampsia may result from inhibition of vascular endothelial growth factor (VEGF) signaling. J Clin Endocrinol Metab 2011; 96: E1148-52.
DOI URL |
8. |
Muller WA. Leukocyte-endothelial-cell interactions in leukocyte transmigration and the inflammatory response. Trends Immunol 2003; 24: 327-34.
DOI PMID |
9. | Cheung K, Ma L, Wang G, et al. CD31 signals confer immune privilege to the vascular endothelium. Proc Natl Acad Sci USA 2015; 112: E5815-24. |
10. |
Zheng Y, Han Z, Zhao H, Luo Y. MAPK: a key player in the development and progression of stroke. CNS Neurol Disord Drug Targets 2020; 19: 248-56.
DOI URL |
11. |
Liu B, Liu YJ. Carvedilol promotes retinal ganglion cell survival following optic nerve injury via ASK1-p38 MAPK Pathway. CNS Neurol Disord Drug Targets 2019; 18: 695-704.
DOI URL |
12. |
He L, Shi X, Seto SW, et al. Using 3D-UPLC-DAD and a new method-verification by adding mixture standard compounds to determine the fingerprint and eight active components of Naoluoxintong decoction. J Pharm Biomed Anal 2019; 169: 60-9.
DOI PMID |
13. |
Bu L, Dai O, Zhou F, et al. Traditional Chinese Medicine formulas, extracts, and compounds promote angiogenesis. Biomed Pharmacother 2020; 132: 110855.
DOI PMID |
14. | Xu SY. Pharmacological experimental methodology. Beijing: People's Medical Publishing House 1982: 535. |
15. | Tan H, Yin T, Deng Y, He L, Li F, Wang Y. Mechanisms of Yiqihuoxue herb Naoluoxintong promotes cerebral vascular regeneration in rats with cerebral ischemia syndrome of Qi deficiency accompanied by blood stasis. Xi Bao Yu Fen Zi Mian Yi Xue Za Zhi 2020; 36: 712-8. |
16. |
Longa EZ, Weinstein PR, Carlson S, Cummins R. Reversible middle cerebral artery occlusion without craniectomy in rats. Stroke 1989; 20: 84-91.
DOI PMID |
17. |
Weidner N. Intratumor microvessel density as a prognostic factor in cancer. Am J Pathol 1995; 147: 9-19.
PMID |
18. |
Ma C, Wang X, Xu T, et al. Qingkailing injection ameliorates cerebral ischemia-reperfusion injury and modulates the AMPK/ NLRP 3 inflammasome signalling pathway. BMC Complement Altern Med 2019; 19: 320.
DOI |
19. |
Beck H, Plate KH. Angiogenesis after cerebral ischemia. Acta Neuropathol 2009; 117: 481-96.
DOI PMID |
20. |
Beck H, Acker T, Wiessner C, Allegrini PR, Plate KH. Expression of angiopoietin-1, angiopoietin-2, and tie receptors after middle cerebral artery occlusion in the rat. Am J Pathol 2000; 157: 1473-83.
PMID |
21. |
Soker S, Miao HQ, Nomi M, Takashima S, Klagsbrun M. VEGF165 mediates formation of complexes containing VEGFR-2 and neuropilin-1 that enhance VEGF165-receptor binding. J Cell Biochem 2002; 85: 357-68.
PMID |
22. |
Marti HH, Risau W. Systemic hypoxia changes the organ-specific distribution of vascular endothelial growth factor and its receptors. Proc Natl Acad Sci USA 1998; 95: 15809-14.
DOI PMID |
23. |
Monacci WT, Merrill MJ, Oldfield EH. Expression of vascular permeability factor/vascular endothelial growth factor in normal rat tissues. Am J Physiol 1993; 264: C995-1002.
DOI URL |
24. |
Zhao Y, Fu B, Chen P, et al. Activated mesangial cells induce glomerular endothelial cells proliferation in rat anti-Thy-1 nephritis through VEGFA/VEGFR2 and Angpt2/Tie2 pathway. Cell Prolif 2021; 54: e13055.
DOI URL |
25. |
Liang N, Li Y, Chung HY. Two natural eudesmane-type sesquiterpenes from Laggera alata inhibit angiogenesis and suppress breast cancer cell migration through VEGF- and Angiopoietin 2-mediated signaling pathways. Int J Oncol 2017; 51: 213-22.
DOI PMID |
26. |
Feng YH, Li LF, Zhang Q, et al. Microtubule associated protein 4 (MAP4) phosphorylation reduces cardiac microvascular density through NLRP3-related pyroptosis. Cell Death Discov 2021; 7: 213.
DOI |
27. |
Piera-Velazquez S, Jimenez SA. Endothelial to mesenchymal transition: role in physiology and in the pathogenesis of human diseases. Physiol Rev 2019; 99: 1281-324.
DOI PMID |
28. |
Figueiredo CC, Pereira NB, Pereira LX, et al. Double immunofluorescence labeling for CD31 and CD105 as a marker for polyether polyurethane-induced angiogenesis in mice. Histol Histopathol 2019; 34: 257-64.
DOI PMID |
29. |
Wang Y, Zhang L, Pan YJ, et al. Investigation of invigorating Qi and activating blood circulation prescriptions in treating Qi deficiency and blood stasis syndrome of ischemic stroke patients: study protocol for a randomized controlled trial. Front Pharmacol 2020; 11: 892.
DOI PMID |
30. |
Yao C, Li A, Gao W, Pallua N, Steffens G. Improving the angiogenic potential of collagen matrices by covalent incorporation of Astragalus polysaccharides. Int J Burns Trauma 2011; 1: 17-26.
PMID |
31. |
Yang BR, Cheung KK, Zhou X, et al. Amelioration of acute myocardial infarction by saponins from flower buds of Panax Notoginseng via pro-angiogenesis and anti-apoptosis. J Ethnopharmacol 2016; 181: 50-8.
DOI URL |
32. | Yuan R, Shi W, Xin Q, et al. Tetramethylpyrazine and paeoniflorin inhibit oxidized LDL-induced angiogenesis in human umbilical vein endothelial cells via VEGF and Notch pathways. Evid Based Complement Alternat Med 2018; 2018: 3082507. |
33. |
Xu W, Yang J, Wu LM. Cardioprotective effects of tanshinone IIA on myocardial ischemia injury in rats. Pharmazie 2009; 64: 332-336.
PMID |
34. |
Hu Z, Wang H, Fan G, et al. Danhong injection mobilizes endothelial progenitor cells to repair vascular endothelium injury via upregulating the expression of Akt, eNOS and MMP-9. Phytomedicine 2019; 61: 152850.
DOI URL |
35. |
Liu M, Zhao L, Han L, et al. Discovery and identification of proangiogenic chemical markers from Gastrodiae Rhizoma based on zebrafish model and metabolomics approach. Phytochem Anal 2020; 31: 835-45.
DOI URL |
36. | Wang LN, He L, Cheng H, et al. Effects of centipede extraction on vWF and TPO expression in blood plasm after focal cerebral ischemia-reperfusion injury in rats. Zhong Guo Shi Yan Fang Ji Xue Za Zhi 2012; 18: 192-5. |
[1] | QIN Xiaoyu, WANG Chunai, XUE Jianjun, ZHANG Jie, LU Xiaoting, DING Shengshuang, GE Long, WANG Minzhen. Efficacy of electroacupuncture on myocardial protection and postoperative rehabilitation in patients undergoing cardiac surgery with cardiopulmonary bypass: a systematic review and Meta-analysis [J]. Journal of Traditional Chinese Medicine, 2024, 44(1): 1-15. |
[2] | SUN Qianhui, CHENG Kai, DAI Xingye, YANG Zhiwen, WU Xiaoling, XU Chang, QIU Xinghua, GAO Xiaofeng, LIU Daonan, YANG Qirui. Effect of electroacupuncture at Neiguan (PC6) at different time points on myocardial ischemia reperfusion arrhythmia in rats [J]. Journal of Traditional Chinese Medicine, 2024, 44(1): 113-121. |
[3] | YANG Ye, CHEN Xiaoyang, YAO Junkai, HU Yueyao, WANG Wei. Efficacy of Danlou tablet (丹蒌片) on myocardial ischemia/ reperfusion injury assessed by network pharmacology and experimental verification [J]. Journal of Traditional Chinese Medicine, 2024, 44(1): 131-144. |
[4] | CHENG Kunming, YUAN Jianan, LIU Jun, ZHANG Shengpeng, XU Qixiang, XIE Yong, ZHAO Jingfeng, ZHANG Xiaoxu, TANG Xudong, ZHENG Yongqiu, WANG Zhong. Identifying Qingkailing (清开灵) ingredients-dependent mesenchymal-epithelial transition factor-axiation “π” structuring module with angiogenesis and neurogenesis effects [J]. Journal of Traditional Chinese Medicine, 2024, 44(1): 35-43. |
[5] | JIANG Jianzhen, ZHANG Xin, LUO Zhenguo, SU Chengguo, ZHOU Haiyan, JIANG Yuqing, XIAO Xianjun, CHEN Yunfei, ZHU Jun. Efficacy of electroacupuncture stimulating Zusanli (ST36) and Xuanzhong (GB39) on synovial angiogenesis in rats with adjuvant arthritis [J]. Journal of Traditional Chinese Medicine, 2023, 43(5): 955-962. |
[6] | LI Miao, ZHENG Jialu, WANG Shuangshuang, CHEN Lei, PENG Xiao, CHEN Jinfang, AN Hongmei, HU Bing. Tenglong Buzhong granules (藤龙补中颗粒) inhibits the growth of SW620 human colon cancer in vivo [J]. Journal of Traditional Chinese Medicine, 2022, 42(5): 701-706. |
[7] | WEI Xiaotong, LI Liaoyuan, ZHANG Yating, SHU Qi, WANG Shuaiya, CHEN Pianpian, HU Ling, YU Qing, CAI Ronglin. Electroacupuncture preconditioning alleviates myocardial ischemia-reperfusion injury through the hypothalamic paraventricular nucleus- interposed nucleus nerve pathway [J]. Journal of Traditional Chinese Medicine, 2022, 42(3): 379-388. |
[8] | LI Yuanqi, LI Weili, YU Xinhui, WU Hua, WANG Yuanzhong, JIN Ya, HAO Lele, LIU Mingmin, SONG Xiaoge. Mechanisms of Traditional Chinese Medicine Bushenantai granules (补肾安胎颗粒) in promoting angiogenesis at the maternal-fetal interface of recurrent spontaneous abortion mice [J]. Journal of Traditional Chinese Medicine, 2021, 41(4): 556-563. |
[9] | ZHANG Qiongzhi, FU Tingting, DAI Jianing, ZHOU Zhinan, SHEN Cuizhen. Sodium Danshensu promotes the healing of stage 2 pressure injury wounds in ischemia/reperfusion injury rat models: possible regulation of apoptosis and inflammatory response [J]. Journal of Traditional Chinese Medicine, 2021, 41(4): 571-580. |
[10] | HAN Yongli, CHEN Song, PENG Xingming. Electroacupuncture Pretreatment at Neiguan (PC 6) attenuates autophagy in rats with myocardial ischemia reperfusion through the phosphatidylinositol 3-kinase-Akt-mammalian target of rapamycin pathway [J]. Journal of Traditional Chinese Medicine, 2021, 41(3): 455-462. |
[11] | Xu Chengyong, Wang Yuguo, Feng Jian, Xu Ran, Dou Yongqi. Extracts from Huangqi(Radix Astragali Mongoliciplus) and Ezhu(Rhizoma Curcumae Phaeocaulis) inhibit Lewis lung carcinoma cell growth in a xenograft mouse model by impairing mitogen-activated protein kinase signaling, vascular endothelial growth factor prod [J]. Journal of Traditional Chinese Medicine, 2019, 39(04): 559-565. |
[12] | Deng Xin, Liang Xingqiu, Zhou Xiaoxiao, Jiang Manjun, Liang Mingkun, Wang Xinyuan, Zhao Xiaofang, Fu Lei, Liang Jian. Protective effect and mechanisms of Weining granule on N-methyl-N'-nitro-N-nitrosoguanidine-induced gastric cancer in rats [J]. Journal of Traditional Chinese Medicine, 2019, 39(03): 393-401. |
[13] | Tian Yuefeng, Gao Haining, Li Leiyong, Wang Jun, Zhai Chuntao. Effect of electroacupuncture at Ximen(PC 4) and Hegu(LI 4) on expression of Akt in rats with myocardial ischemia-reperfusion injury [J]. Journal of Traditional Chinese Medicine, 2017, 37(06): 835-840. |
[14] | Li Jing, Bai Zonglu, Du Yuanhao, Li Yongfeng, Zhang Xuezhu, Pang Bo, Zhang Jingjing. Effect of electroacupuncture on expression of Ang/Tie-2 mRNA and protein in rats with acute cerebral infarction [J]. Journal of Traditional Chinese Medicine, 2017, 37(05): 659-666. |
[15] | Yang Yongxia, Chen Xi, Wang Shumei, Wang Zhanhong, Li Jiansheng, Liang Shengwang. Neuroprotective effect of Naomaitong extract following focal cerebral ischemia induced by middle cerebral artery occlusion in rats [J]. Journal of Traditional Chinese Medicine, 2017, 37(03): 333-340. |
Viewed | ||||||||||||||||||||||||||||||||||||||||||||||||||
Full text 221
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||
Abstract 150
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||
Sponsored by China Association of Chinese Medicine
& China Academy of Chinese Medical Sciences
16 Nanxiaojie, Dongzhimen Nei, Beijing, China. 100700 Email: jtcmen@126.com
Copyright 2020 Journal of Traditional Chinese Medicine. All rights reserved.