Yemazhui (Herba Eupatorii Lindleyani) ameliorates lipopolysaccharide-induced acute lung injury via modulation of the toll-like receptor 4/nuclear factor kappa-B/nod-like receptor family pyrin domain-containing 3 protein signaling pathway and intestinal flora in rats

doi:10.19852/j.cnki.jtcm.20230510.001

Abstract

Abstract:

OBJECTIVE: To investigate the impact of Yemazhui (Herba Eupatorii Lindleyani, HEL) against lipopolysaccharide (LPS)-induced acute lung injury (ALI) and explore its underlying mechanism in vivo.

METHODS: The chemical constituents of HEL were analyzed by ultra-high performance liquid chromatography-quadrupole time-of-flight mass spectrometry method. Then, HEL was found to suppress LPS-induced ALI in vivo. Six-week-old male Sprague-Dawley rats were randomly divided into 6 groups: control, LPS, Dexamethasone (Dex), HEL low dose 6 g/kg (HEL-L), HEL medium dose 18 g/kg (HEL-M) and HEL high dose 54 g/kg (HEL-H) groups. The model rats were intratracheally injected with 3 mg/kg LPS to establish an ALI model. Leukocyte counts, lung wet/dry weight ratio, as well as myeloperoxidase (MPO) activity were determined followed by the detection with hematoxylin and eosin staining, enzyme linked immunosorbent assay, quantitative real time polymerase chain reaction, western blotting, immunohistochemistry, and immunofluorescence. Besides, to explore the effect of HEL on ALI-mediated intestinal flora, we performed 16s rRNA sequencing analysis of intestinal contents.

RESULTS: HEL attenuated LPS-induced inflammation in lung tissue and intestinal flora disturbance. Mechanism study indicated that HEL suppressed the lung coefficient and wet/dry weight ratio of LPS-induced ALI in rats, inhibited leukocytes exudation and MPO activity, and improved the pathological injury of lung tissue. In addition, HEL reduced the expression of tumor necrosis factor-alpha, interleukin-1beta (IL-1β) and interleukin-6 (IL-6) in bronchoalveolar lavage fluid and serum, and inhibited nuclear displacement of nuclear factor kappa-B p65 (NF-κBp65). And 18 g/kg HEL also reduced the expression levels of toll-like receptor 4 (TLR4), myeloid differentiation factor 88, NF-κBp65, phosphorylated inhibitor kappa B alpha (phospho-IκBα), nod-like receptor family pyrin domain-containing 3 protein (NLRP3), IL-1β, and interleukin-18 (IL-18) in lung tissue, and regulated intestinal flora disturbance.

CONCLUSIONS: In summary, our findings revealed that HEL has a protective effect on LPS-induced ALI in rats, and its mechanism may be related to inhibiting TLR4/ NF-κB/NLRP3 signaling pathway and improving intestinal flora disturbance.

Key words: Yemazhui (Herba Eupatorii Lindleyani), acute lung injury, anti-inflammation, toll-like receptor 4, nuclear factor kappa-B, nod-like receptor family pyrin domain-containing 3 protein, signal transduction, gastrointestinal microbiome

REN Li, HAI Yang, YANG Xue, LUO Xianqin. Yemazhui (Herba Eupatorii Lindleyani) ameliorates lipopolysaccharide-induced acute lung injury via modulation of the toll-like receptor 4/nuclear factor kappa-B/nod-like receptor family pyrin domain-containing 3 protein signaling pathway and intestinal flora in rats[J]. Journal of Traditional Chinese Medicine, 2024, 44(2): 303-314.

Figures/Tables 11

Table 1 Primer sequences used for qRT-PCR

Gene	Forward primer (5’-3’)	Reverse primer (5’-3’)
TNF-α	ATGGGCTCCCTCTCATCAGTTCC	CCTCCGCTTGGTGGTTTGCTAC
IL-1β	AATCTCACAGCAGCATCTCGACAAG	TCCACGGGCAAGACATAGGTAGC
IL-6	ACTTCCAGCCAGTTGCCTTCTTG	TGGTCTGTTGTGGGTGGTATCCTC
GAPDH	GACATGCCGCCTGGAGAAAC	A GCCCAGGATGCCCTTTA GT

Figure 1 Main chemical components of HEL and histopathological changes in lung tissue Base peak chromatogram from UPLC-Q-TOF/MS analysis of HEL under A: positive ion mode and B: negative ion mode. C: representative photomicrographs of HE staining of lung tissues in each group (magnification, × 100). C1: control group (distilled water by gavage for a week); C2: lipopolysaccharide group (distilled water by gavage for a week); C3: dexamethasone group (5 mg/kg by gavage for a week); C4: Yemazhui (Herba Eupatorii Lindleyani) low-dose group (6 g/kg by gavage for a week); C5: Yemazhui (Herba Eupatorii Lindleyani) medium-dose group (18 g/kg by gavage for a week); C6: Yemazhui (Herba Eupatorii Lindleyani) high-dose group (54 g/kg by gavage for a week). HEL: Yemazhui (Herba Eupatorii Lindleyani); UPLC-Q-TOF/MS: ultra-performance liquid chromatography-quadrupole-time of flight-mass spectrometry; HE: hematoxylin and eosin staining.

Table 2 Changes in lung coefficient, wet/dry weight ratio of lung tissue and histopathological score in animals 24 h after induction of the injury ($\bar{x}±s$)

Group	n	Lung coefficient (%)	Wet/dry weight ratio (%)	Histopathological score
Control	9	1.13±0.18	11.14±2.58	1.00±0.50
LPS	9	1.36±0.18^a	17.07±3.71^a	8.05±0.69^d
Dex	9	1.33±0.12^b	11.36±1.94^c	6.50±0.92^c
HEL-L	9	1.21±0.20^c	12.290±1.81^b	7.20±0.68
HEL-M	9	1.24±0.14^b	11.24±2.38^c	6.05±1.23^e
HEL-H	9	1.21±0.24^c	11.66±3.78^b	6.30±1.55^c

Table 3 Changes in leukocytes, neutrophils, lymphocytes count in plasma and MPO activity in lung tissue ($\bar{x}±s$)

Group	n	Leukocyte (%)	Neutrophils (%)	Lymphocytes (%)	MPO activity (U/mg tissue)
Control	6	4.77±0.91	2.00±0.51	2.64±0.92	1.06±0.51
LPS	6	8.50±2.09^a	3.11±1.55	5.41±1.32^e	3.59±2.33^a
Dex	6	4.14±2.15^b	1.94±0.79	0.81±0.55^f	1.46±0.24^c
HEL-L	6	5.80±1.36^c	1.30±0.35^d	3.67±0.81^c	1.92±0.30
HEL-M	6	5.03±2.35^d	1.28±0.59^d	3.65±1.85^c	1.23±0.69^d
HEL-H	6	4.90±1.06^d	2.02±1.01	2.28±0.84^f	1.70±0.16^c

Table 4 Changes in TNF-α, IL-1β and IL-6 in BALF (ng/L, $\bar{x}±s$)

Group	n	TNF-α	IL-1β	IL-6
Control	6	129.8±6.4	14.0±1.0	58.1±2.5
LPS	6	185.9±14.4^a	17.4±1.2^c	77.5±4.1^a
Dex	6	137.1±15.1^b	13.4±1.2^b	61.7±4.5^d
HEL-L	6	138.5±13.2^b	14.2±1.0^d	65.2±4.9^e
HEL-M	6	130.7±12.4^b	14.2±1.1^d	53.1±7.6^b
HEL-H	6	130.3±20.6^b	14.3±1.2^d	66.3±8.1^f

Table 5 Changes in TNF-α, IL-1β and IL-6 in serum (ng/L, $\bar{x}±s$)

Group	n	TNF-α	IL-1β	IL-6
Control	6	223.9±13.6	13.6±1.4	58.5±6.6
LPS	6	262.5±14.3^a	20.1±3.2^d	98.5±14.4^d
Dex	6	235.1±11.3^b	14.4±1.5^e	67.6±6.4^c
HEL-L	6	204.6±8.4^c	16.1±1.5^b	83.6±5.8^b
HEL-M	6	214.0±23.6^c	12.3±1.8^c	73.9±9.1^e
HEL-H	6	196.9±11.9^c	10.9±1.9^c	60.9±7.2^c

Figure 2 Immunohistochemical and immunofluorescent results visualizing TLR4, NF-κBp65, NLRP3 in lung tissue A: A1-A6: microscopic images of TLR4 for Control, LPS, Dex, HEL-L, HEL-M and HEL-H groups as determined by immunohistochemical assays. A7-A12: microscopic images of NF-κBp65 for Control, LPS, Dex, HEL-L, HEL-M and HEL-H groups as determined by immunohistochemical assays. A13-A18: microscopic images of NLRP3 for Control, LPS, Dex, HEL-L, HEL-M and HEL-H groups as determined by immunohistochemical assays. Scale bar: 50 μm. B: B1-B6: confocal merge images of TLR4 for Control, LPS, Dex, HEL-L, HEL-M and HEL-H groups as determined by immunofluorescence assays. B7-B12: confocal merge images of NF-κBp65 for Control, LPS, Dex, HEL-L, HEL-M and HEL-H groups as determined by immunofluorescence assays. B13-B18: confocal merge images of NLRP3 for Control, LPS, Dex, HEL-L, HEL-M and HEL-H groups as determined by immunofluorescence assays. Scale bar: 50 μm. Control: control group (distilled water by gavage for a week); LPS: lipopolysaccharide group (distilled water by gavage for a week); Dex: dexamethasone group (5 mg/kg by gavage for a week); HEL-L: Yemazhui (Herba Eupatorii Lindleyani) low-dose group (6 g/kg by gavage for a week); HEL-M: Yemazhui (Herba Eupatorii Lindleyani) medium-dose group rats (18 g/kg by gavage for a week); HEL-H: Yemazhui (Herba Eupatorii Lindleyani) high-dose group rats (54 g/kg by gavage for a week). HEL: Yemazhui (Herba Eupatorii Lindleyani); TLR4: toll-like receptor 4; NFκBp65: nuclear factor kappa-B p65; NLRP3: nod-like receptor family pyrin domain-containing 3 protein; LPS: lipopolysaccharide.

Table 6 Average integrated optical density of TLR4, NF-κBp65 and NLRP3 in lung tissue (Area%, $\bar{x}±s$)

Group	n	TLR4	NF-κBp65	NLRP3
Control	6	5.1±0.8	1.4±0.2	1.9±0.3
LPS	6	9.4±0.8^a	4.7±0.3^a	4.6±0.4^a
Dex	6	6.0±0.5^b	1.9±0.2^b	3.1±0.6^c
HEL-L	6	7.1±0.5^b	3.2±0.2^b	3.7±0.2^d
HEL-M	6	5.9±0.2^b	2.2±0.2^b	2.9±0.4^b
HEL-H	6	6.4±0.5^b	2.4±0.4^b	3.4±0.4^e

Figure 3 HEL inhibited the TLR4/NF-κB/NLRP3 signaling pathway in vivo A: Western blotting representative images of TLR4, MyD88, NF-κBp65, NF-κB, phospho-IκBα, IκBα, NLRP3, IL-18 and IL-1β proteins. B: B1: Protein expression levels of TLR4; B2: protein expression levels of MyD88; B3: protein expression levels of NF-κBp65; B4: protein expression levels of phospho-IκBα; B5: protein expression levels of NLRP3; B6: protein expression levels of IL-18; B7: protein expression levels of IL-1β. The data were expressed as the mean ± standard deviation (n = 6). Control: control group (distilled water by gavage for a week); LPS: lipopolysaccharide group (distilled water by gavage for a week for a week); HEL: Yemazhui (Herba Eupatorii Lindleyani) medium-dose group rats (18 g/kg by gavage for a week). HEL: Yemazhui (Herba Eupatorii Lindleyani); TLR4: toll-like receptor 4; MyD88: myeloid differentiation primary response protein 88; NF-κB: nuclear factor kappa-B; NF-κBp65: nuclear factor kappa-B p65; IκBα: inhibitor kappa B alpha; phospho-IκBα phosphorylated inhibitor kappa B alpha; NLRP3: nod-like receptor family pyrin domain-containing 3 protein; IL-18: interleukin 18; IL-1β: interleukin-1beta. Compared with the control group, aP < 0.01, cP < 0.001, eP < 0.0001; compared with the LPS group, bP < 0.0001, dP < 0.001, fP < 0.05, gP < 0.01.

Table 7 Levels of TNF-α, IL-1β, and IL-6 mRNA in lung tissue ($\bar{x}±s$)

Group	n	TNF-α	IL-1β	IL-6
Control	6	1.19±0.25	1.14±0.38	0.53±0.19
LPS	6	5.89±2.37^a	2.12±0.91^c	2.19±1.25^a
HEL	6	1.89±1.11^b	1.20±0.17^b	0.89±0.30^b

Figure 4 Intestinal flora analysis of HEL on the cecal contents in vivo A: pan chart by ASV analysis. B: rank abundance chart. C: sobs index represents α diversity. D: PCA analysis of gut bacterial community based on the genus level. E1: venn chart based on OTU at the phylum levels; E2: venn chart based on OTU at the genus levels. F1: stacking diagram of community composition structure at the phylum levels; F2: stacking diagram of community composition structure at the genus levels. G: correlation between intestinal flora and lung injury index or Inflammatory cytokines. The above data were analyzed in control, LPS and HEL groups (n = 6). Control: control group (distilled water by gavage for a week for a week); LPS: lipopolysaccharide group (distilled water by gavage for a week); HEL: Yemazhui (Herba Eupatorii Lindleyani) medium-dose group rats (18 g/kg by gavage for a week). HEL: Yemazhui (Herba Eupatorii Lindleyani), ASV: amplicon sequence variants, PCA: principal component analysis, OTU: operational taxonomic units.

References 42.

1.	Confalonieri M, Salton F, Fabiano F. Acute respiratory distress syndrome. Eur Respir Rev 2017; 26: 160116. DOI URL
2.	Thompson BT, Chambers RC, Liu KD. Acute Respiratory Distress Syndrome. N Engl J Med 2017; 377: 562-72. DOI URL
3.	Zhang H, Wang H, Lu D, et al. Berberine inhibits cytosolic phospholipase a2 and protects against LPS-induced lung injury and lethality independent of the α2-adrenergic receptor in mice. Shock 2008; 29: 617-22. DOI URL
4.	Mokra D, Kosutova P. Biomarkers in acute lung injury. Resp Physiol Neurobi 2015; 209: 52-8. DOI URL
5.	Zheng J, Lu C, Yang M, et al. Lung-targeted delivery of cepharanthine by an erythrocyte-anchoring strategy for the treatment of acute lung injury. Pharmaceutics 2022; 14: 1820. DOI URL
6.	Mokra D. Acute lung injury-from pathophysiology to treatment. Physiol Res 2020; 69: S353-66.
7.	Mokra D, Mikolka P, Kosutova P, Mokry J. Corticosteroids in acute lung injury: the dilemma continues. Int J Mol Sci 2019; 20: 4765. DOI URL
8.	Chen H, Bai C, Wang X. The value of the lipopolysaccharide-induced acute lung injury model in respiratory medicine. Expert Rev Resp Med 2010; 4: 773-83. DOI PMID
9.	Han X, Wu YC, Meng M, Sun QS, Gao SM, Sun H. Linarin prevents LPS‑induced acute lung injury by suppressing oxidative stress and inflammation via inhibition of TXNIP/NLRP3 and NF‑κB pathways. Int J Mol Med 2018; 42: 1460-72.
10.	Yang X, An X, Wang C, et al. Protective effect of oxytocin on ventilator-induced lung injury through NLRP3-mediated pathways. Front Pharmacol 2021; 12: 722907. DOI URL
11.	Kelley N, Jeltema D, Duan Y, He Y. The NLRP3 inflammasome: an overview of mechanisms of activation and regulation. Int J Mol Sci 2019; 20: 3328. DOI URL
12.	Wu Y, Wang Y, Gong S, et al. Ruscogenin alleviates LPS-induced pulmonary endothelial cell apoptosis by suppressing TLR4 signaling. Biomed Pharmacother 2020; 125: 109868. DOI PMID
13.	Yin L, Zhang G, Yan X, Wang Y, Xu Y, Yang Y. An in vivo and in vitro evaluation of the mutual interactions between the lung and the large intestine. Evid Based Complement Alternat Med 2013; 2013: 1-9.
14.	Dickson RP, Singer BH, Newstead MW, et al. Enrichment of the lung microbiome with gut bacteria in sepsis and the acute respiratory distress syndrome. Nat Microbiol 2016; 1: 16113. DOI PMID
15.	Zhang D, Li S, Wang N, Tan H, Zhang Z, Feng Y. The cross-talk between gut microbiota and lungs in common lung diseases. Front Microbiol 2020; 11: 301. DOI PMID
16.	Wang X, Ma S, Lai F, Wang Y, Lou C. Traditional applications, phytochemistry, and pharmacological activities of Eupatorium lindleyanum DC.: a comprehensive review. Front Pharmacol 2020; 8: 577124. DOI URL
17.	Ding Z, Zhong R, Xia T, et al. Advances in research into the mechanisms of Chinese Materia Medica against acute lung injury. Biomed Pharmacother 2020; 122: 109706. DOI PMID
18.	Wang X, Xu J, Tao Y, Fan X, Shen X, Tian S. Eupatorium lindleyanum DC. sesquiterpene fraction F1012-2 regulates p53/NF-κB signaling pathways in human breast cancer. Arch Biol Sci 2022; 74: 291-9. DOI URL
19.	Li C, Chen S, Sha J, et al. Extraction and purification of total flavonoids from Eupatorium lindleyanum DC. and evaluation of their antioxidant and enzyme inhibitory activities. Food Sci Nutr 2021; 9: 2349-63. DOI URL
20.	Wang F, Zhong H, Fang S, et al. Potential anti-inflammatory sesquiterpene lactones from Eupatorium lindleyanum. Planta Med 2018; 84: 123-8. DOI PMID
21.	Shen X, Hu H, Xu J, Tian S. Prediction targets of a novel sesquiterpene lactone from Eupatorium lindleyanum DC. against viral pneumonia using computational pharmacology. Nat Prod Commun 2022; 17: 1934578X-2211314X.
22.	Liu J, Huang X, Hu S, He H, Meng Z. Dexmedetomidine attenuates lipopolysaccharide induced acute lung injury in rats by inhibition of caveolin-1 downstream signaling. Biomed Pharmacother 2019; 118: 109314. DOI URL
23.	Chimenti L, Camprubí-Rimblas M, Guillamat-Prats R, et al. Nebulized Heparin attenuates pulmonary coagulopathy and inflammation through alveolar macrophages in a rat model of acute lung injury. Thromb Haemostasis 2017; 117: 2125-34. DOI PMID
24.	Chinese Pharmacopoeia Commission. Pharmacopoeia of the People's Republic of China. Beijing: China Medical Science Press, 2020: 326.
25.	Li Z, Liu J, Zhang D, et al. Nuciferine and paeoniflorin can be quality markers of Tangzhiqing tablet, a Chinese traditional patent medicine, based on the qualitative, quantitative and dose-exposure-response analysis. Phytomedicine 2018; 44: 155-63. DOI PMID
26.	Ludden TM. Nonlinear pharmacokinetics: clinical implications. Clin Pharmacokinet 1991; 6: 429-46. DOI URL
27.	Matute-Bello G, Frevert CW, Martin TR. Animal models of acute lung injury. Am J Physiol Lung Cell Mol Physiol 2008; 295: L379-99. DOI URL
28.	Lei J, Wei Y, Song P, et al. Cordycepin inhibits LPS-induced acute lung injury by inhibiting inflammation and oxidative stress. Eur J Pharmacol 2018; 818: 110-4. DOI PMID
29.	Chu C, Ren H, Xu N, Xia L, Chen D, Zhang J. Eupatorium lindleyanum DC. sesquiterpenes fraction attenuates lipopolysaccharide-induced acute lung injury in mice. J Ethnopharmacol 2016; 185: 263-71. DOI PMID
30.	Chu C, Yao S, Chen J, et al. Eupatorium lindleyanum DC. flavonoids fraction attenuates lipopolysaccharide-induced acute lung injury in mice. Int Immunopharmacol 2016; 39: 23-33. DOI PMID
31.	Orecchioni M, Ghosheh Y, Pramod AB, Ley K. Macrophage polarization: different gene signatures in M1 (LPS+) vs classically and M2 (LPS-) vs alternatively activated macrophages. Front Immunol 2019; 101084.
32.	Zhao K, Li X, Yang J, et al. Protective effect of Amomum Roxb. essential oils in lipopolysaccharide-induced acute lung injury mice and its metabolomics. J Ethnopharmacol 2022; 290: 115119. DOI URL
33.	Wu J, Yan Z, Schwartz DE, Yu J, Malik AB, Hu G. Activation of NLRP3 inflammasome in alveolar macrophages contributes to mechanical stretch-induced lung inflammation and injury. J Immunol 2013; 190: 3590-9. DOI PMID
34.	Sharif H, Wang L, Wang WL, et al. Structural mechanism for NEK7-licensed activation of NLRP3 inflammasome. Nature 2019; 570: 338-43. DOI
35.	Patel MN, Carroll RG, Galván-Peña S, et al. Inflammasome priming in sterile inflammatory disease. Trends Mol Med 2017; 23: 165-80. DOI PMID
36.	Liu P, Wang P, Tian D, Liu J, Chen G, Liu S. Study on Traditional Chinese Medicine theory of lung being con- nected with large intestine. J Tradit Chin Med 2012; 1: 1-2.
37.	Wedgwood S, Gerard K, Halloran K, et al. Intestinal dysbiosis and the developing lung: the role of toll-like receptor 4 in the gut-lung axis. Front Immunol 2020; 11: 357. DOI PMID
38.	Tang J, Xu L, Zeng Y, Gong F. Effect of gut microbiota on LPS-induced acute lung injury by regulating the TLR4/NF-kB signaling pathway. Int Immunopharmacol 2021; 91: 107272. DOI URL
39.	Zhou B, Yuan Y, Zhang S, et al. Intestinal flora and disease mutually shape the regional immune system in the intestinal tract. Front Immunol 2020; 11: 575. DOI PMID
40.	Yildirim E, Ilina L, Laptev G, et al. The structure and functional profile of ruminal microbiota in young and adult reindeers (Rangifer tarandus) consuming natural winter-spring and summer-autumn seasonal diets. Peer J 2021; 9: e12389. DOI URL
41.	Guo Y, Huang S, Zhao L, Zhang J, Ji C, Ma Q. Pine (Pinus massoniana Lamb.) needle extract supplementation improves performance, egg quality, serum parameters, and the gut microbiome in laying hens. Front Nutr 2022; 9: 810462. DOI URL
42.	Zhao Z, Fei K, Bai H, Wang Z, Duan J, Wang J. Metagenome association study of the gut microbiome revealed biomarkers linked to chemotherapy outcomes in locally advanced and advanced lung cancer. Thorac Cancer 2021; 12: 66-78. DOI PMID

[1]	YU Zhengqiu, YU Liuda, CHEN Ye, LI Mingjing, CAI Wanru. Effectiveness and safety of Qidong Huoxue decoction (芪冬活血饮) in treatment of acute lung injury and acute respiratory distress syndrome: a randomized, controlled trial [J]. Journal of Traditional Chinese Medicine, 2024, 44(2): 381-387.
[2]	LI Liusheng, ZHAO Mingming, CHANG Meiying, SI Yuan, ZHAO Jinning, YANG Bin, ZHANG Yu. Protective effect of modified Huangqi Chifeng decoction (加味黄芪赤风汤) on immunoglobulin A nephropathy through toll-like receptor 4/myeloid differentiation factor 88/nuclear factor-kappa B signaling pathway [J]. Journal of Traditional Chinese Medicine, 2024, 44(2): 324-333.
[3]	ZHENG Xueying, GUO Liang, LAI Siyi, LI Fengyue, LIANG Mingli, LIU Wanting, MENG Chun, LIU Guanghui. Emodin suppresses alkali burn-induced corneal inflammation and neovascularization by the vascular endothelial growth factor receptor 2 signaling pathway [J]. Journal of Traditional Chinese Medicine, 2024, 44(2): 268-276.
[4]	CHANG Fengjin, ZHOU Peng, LI Guoying, ZHANG Weizhi, ZHANG Yanyan, PENG Daiyin, CHEN Guangliang. Taohong Siwu decoction (桃红四物汤) ameliorates atherosclerosis in rats possibly through toll-like receptor 4/myeloid differentiation primary response protein 88/nuclear factor-κB signal pathway [J]. Journal of Traditional Chinese Medicine, 2024, 44(1): 103-112.
[5]	ZHI Guoguo, SHAO Bingjie, ZHENG Tianyan, JI Shaoxiu, LI Jingwei, DANG Yanni, LIU Feng, WANG Dong. Efficacy of Ganshuang granules (肝爽颗粒) on non-alcoholic fatty liver and underlying mechanism: a network pharmacology and experimental verification [J]. Journal of Traditional Chinese Medicine, 2024, 44(1): 122-130.
[6]	LIU Huihui, FENG Jun, LIU Jianhe, CHENG Choufu, HU Guoheng. Efficacy of Jiangzhi Xiaoban tablet (降脂消斑片) on toll-like receptor 4/nuclear factor-kappa B/nod-like receptor protein 3 signaling pathway in mice with atherosclerosis induced by high-fat diet [J]. Journal of Traditional Chinese Medicine, 2024, 44(1): 88-94.
[7]	LI Xiaohua, DUAN Zhihang, YUE Jianjun, ZHANG Yongyu, LI Yihang, LIU Shifang, NIE Qu, YANG Depo, ZHANG Lixia. Bornyl acetate extracted from Sharen (Fructus Amomi) inhibits proliferation, invasion and induces apoptosis by suppressing phosphatidylinositol-3-kinase/protein kinase B signaling in colorectal cancer [J]. Journal of Traditional Chinese Medicine, 2023, 43(6): 1081-1091.
[8]	DU Zhongheng, CONG Wenjie, TANG Kejing, ZHENG Qiqi, SONG Zhiwei, CHEN Yong, YANG Su, ZHANG Chunwu, YE Tianshen. Electroacupuncture stimulating Zusanli (ST36), Sanyinjiao (SP6) in mice with collagen-induced arthritis leads to adenosine A2A receptor-mediated alteration of p38α mitogen-activated protein kinase signaling and inhibition of osteoclastogenesis [J]. Journal of Traditional Chinese Medicine, 2023, 43(6): 1103-1109.
[9]	LIU Yue, ZHANG Fan, HAN Xiaomeng, XU Ningyang, ZHAO Yu, WANG Qige, WANG Jianan, LU Bingjiu, Zhang Yan. Jianpi Qutan Fang (健脾祛痰方) induces anti-atherosclerosis and ameliorates endothelial cell injury in high-fat diet rats via an anti-inflammatory and inhibiting Janus kinase/signal transducer and activator of transcription signaling pathway [J]. Journal of Traditional Chinese Medicine, 2023, 43(6): 1168-1175.
[10]	LI Chaoran, YANG Yan, FENG Chuwen, LI Heng, QU Yuanyuan, WANG Yulin, WANG Delong, WANG Qingyong, GUO Jing, SHI Tianyu, SUN Xiaowei, WANG Xue, HOU Yunlong, SUN Zhongren, YANG Tiansong. Integrated 'omics analysis for the gut microbiota response to moxibustion in a rat model of chronic fatigue syndrome [J]. Journal of Traditional Chinese Medicine, 2023, 43(6): 1176-1189.
[11]	WANG Miao, ZHU Yan, ZHAO Hui, ZHAO Hongfang. Moxibustion enables protective effects on rheumatoid arthritis-induced myocardial injury via transforming growth factor beta1 signaling and metabolic reprogramming [J]. Journal of Traditional Chinese Medicine, 2023, 43(6): 1190-1199.
[12]	YANG Xirui, ZHAO Hui, SHAN Muhammad, DONG Feixue, ZHANG Dandan, WANG Jixue, YUAN Xingxing. Efficacy of bioactive compounds of Chaihu (Radix Bupleuri Chinensis) on glaucomatous optic atrophy through interleukin-6/hypoxia inducible factor-1α signal pathway [J]. Journal of Traditional Chinese Medicine, 2023, 43(6): 1219-1226.
[13]	YANG Xiaohui, WANG Jian, CHENG Li, ZHANG Yuxi, HUANG Jianlin, LIU Minghua. Active compounds of Caodoukou (Semen Alpinia Katsumadai) inhibit the migration, invasion and metastasis of human pancreatic cancer cells by targeting phosphoinosmde-3-kinase/ protein kinase B/mammalian target of rapamycin pathway [J]. Journal of Traditional Chinese Medicine, 2023, 43(5): 876-886.
[14]	LIU Bingbing, LI Jieru, SI Jianchao, CHEN Qi, YANG Shengchang, JI Ensheng. Ginsenoside Rb1 alleviates chronic intermittent hypoxia-induced diabetic cardiomyopathy in db/db mice by regulating the adenosine monophosphate-activated protein kinase/Nrf2/heme oxygenase-1 signaling pathway [J]. Journal of Traditional Chinese Medicine, 2023, 43(5): 906-914.
[15]	JIANG Jianzhen, ZHANG Xin, LUO Zhenguo, SU Chengguo, ZHOU Haiyan, JIANG Yuqing, XIAO Xianjun, CHEN Yunfei, ZHU Jun. Efficacy of electroacupuncture stimulating Zusanli (ST36) and Xuanzhong (GB39) on synovial angiogenesis in rats with adjuvant arthritis [J]. Journal of Traditional Chinese Medicine, 2023, 43(5): 955-962.

Home

Online First

Author Center

Reviewer Center

Issues

Announcement

About Us