Effect of moxibustion on autophagy and the inflammatory response of synovial cells in rheumatoid arthritis model rats

doi:10.19852/j.cnki.jtcm.20210324.002

Journal of Traditional Chinese Medicine ›› 2022, Vol. 42 ›› Issue (1): 73-82.DOI: 10.19852/j.cnki.jtcm.20210324.002

• Research Articles • Previous Articles Next Articles

Effect of moxibustion on autophagy and the inflammatory response of synovial cells in rheumatoid arthritis model rats

Feng HAO¹^,², Qiang WANG³, Lei LIU⁴, Libin WU⁴, Ronglin CAI⁴^,⁵, Jiajia SANG⁶, Jun HU⁷, Jie WANG⁴^,⁵, Qing YU⁴^,⁵, Lu HE⁴^,⁵, Yingchao SHEN³, Yiming MIAO³, Ling HU⁴^,⁵, Zijian WU⁴^,⁵()

1 College of Acupuncture-moxibustion and Tuina, Nanjing University of Chinese Medicine, Nanjing 210023, China
2 Translational Medicine Research Center of Nanjing University of Chinese Medicine, Nanjing 210023, China
3 Changshu Hospital Affiliated to Nanjing University of Chinese Medicine, Changshu 215500, China
4 College of Acupuncture-moxibustion and Tuina, Anhui University of Chinese Medicine, Hefei 230012, China
5 Institute of Acupuncture and Meridian, Anhui Academy of Chinese Medicine, Hefei 230038, China
6 Affiliate Hospital of Nanjing University of Chinese Medicine/Jiangsu Province of Chinese Medicine, Nanjing 210029, China
7 The first clinical medical college of Nanjing University of Chinese Medicine, Nanjing 210029, China

Received:2020-11-21 Accepted:2021-02-16 Online:2022-02-15 Published:2021-03-24
Contact: Ling HU,Zijian WU
About author:WU Zijian, HU Ling, College of Acupuncture-moxibustion and Tuina, Anhui University of Chinese Medicine, Hefei, 230012, China; Institute of Acupuncture and Meridian, Anhui Academy of Chinese Medicine, Hefei, 230038, China. wuzijian@ahtcm.edu.cn; hulingtcm@126.com
Supported by:
University Natural Science Research Program of Jiangsu: Study on the Mechanism Of Moxibustion Regulating Autophagy in RA synovial Fibroblasts Based on PI3K/Akt/mTOR Pathway(18KJB360005);973 Program of China: Effect and Biological Mechanism of Heat, Light and Smoking in Moxibustion(2015CB554504);Priority Academic Program Development of Jiangsu Higher Education Institutions(Integration of Chinese and Western Medicine);Exploration and Scientific Research Project of Anhui University of Chinese Medicine: Clinical Application and Mechanism Study of Moxibustion(2016ts024)

Abstract

Abstract:

OBJECTIVE: To investigate the effect of moxibustion on synovitis and the autophagy of synoviocytes in rheumatoid arthritis (RA).

METHODS: Forty Sprague-Dawley rats were randomly divided into a normal group, model group, moxibustion group, cigarette moxibustion group, and medicine group, with eight rats included in each group. The RA model was established by subcutaneous injection of complete Freund's adjuvant into the left posterior toe. Rats in the model group were not interfered with. In the moxibustion group, rats were treated by moxibustion, where a 1-cm diameter moxa stick was applied at the left Zusanli (ST 36) point. The distance of the moxa stick to the skin was 2 cm and moxibustion was completed for 20 min daily for 15 d total. In the cigarette moxibustion group, the moxa stick was replaced by a common cigarette. In the medicine group, rats were treated with a tripterygium glycoside suspension (8 mg/kg) once a day for 15 d total. In each group, the left hind limb toe volume was measured with a toe volume meter; the synovial cells were observed by hematoxylin and eosin staining; the interleukin (IL)-4, IL-6, IL-10, IL-1β, IL-23, IL-17, and tumor necrosis factor (TNF)-α levels in serum were measured by enzyme-linked immunosorbent assay; the erythrocyte sedimentation rate (ESR) were detected by Westergren sedimentation rate testing; the C-reactive protein (CRP) and rheumatoid factor (RF) levels in serum were detected by rate nephelometry; the expression levels of ULK1, autophagy-associated protein (Atg)3, Atg5, and Atg12 messenger RNA (mRNA) in synovium were detected by real time-quantitative polymerase chain reaction (RT-qPCR); and the protein expression levels of phosphatidylinositol-3-kinase (PI3K), protein kinase B (Akt), mammalian target of rapamycin (mTOR), LC3-Ⅱ, beclin-1, phosphorylated-PI3K (p-PI3K), p-Akt, p-mTOR in synovium were detected by Western blotting.

RESULTS: Among the RA model rats, joint swelling, an inflammatory reaction, and the proliferation of synovial tissue were obvious and the signal of the PI3K/Akt/mTOR pathway was active, while autophagy was inhibited. Moxibustion at Zusanli (ST36) or intragastric administration of Tripterygium wilfordii glycosides could alleviate the inflammatory reaction of RA rats; relieve the swelling of the toes; downregulate the levels of ESR, CRF, RF; lower the levels of IL-6, IL-1β, TNF-α, and IL-17; and increase the IL-4 and IL-10. At the same time, the mRNA expression levels of ULK1, Atg3, Atg5, and Atg12 and those of LC3-Ⅱ and beclin-1 were increased, while the PI3K, Akt, mTOR, p-PI3K, p-Akt, p-mTOR were decreased. Cigarette moxibustion did not significantly reduce the swelling of the toe joint in RA rats, and was not as good as that of moxibustion or Tripterygium wilfordii polyglycosides in the effects of inflammation relief and the influences of the levels of ESR, CRF, RF. While cigarette moxibustion has a weak effect to affect the expression of corresponding molecules in autophages and the expression level of the autophagy biomaker in synovial tissue. Moxibustion and tripterygium glycosides can significantly reduce the joint swelling, relieve synovitis and synovial hyperplasia, and inhibit the PI3K/ Akt/mTOR signaling pathway to increase autophagy in a manner superior to cigarette moxibustion.

CONCLUSION: Moxibustion can limit the proliferation of synoviocytes in RA rats by inhibiting the PI3K/Akt/mTOR signaling pathway, promoting autophagy, effectively reducing synovitis, and alleviating joint swelling.

Key words: moxibustion, arthritis, rheumatoid, synovitis, autophagy

Feng HAO, Qiang WANG, Lei LIU, Libin WU, Ronglin CAI, Jiajia SANG, Jun HU, Jie WANG, Qing YU, Lu HE, Yingchao SHEN, Yiming MIAO, Ling HU, Zijian WU. Effect of moxibustion on autophagy and the inflammatory response of synovial cells in rheumatoid arthritis model rats[J]. Journal of Traditional Chinese Medicine, 2022, 42(1): 73-82.

Figures/Tables 7

Table 1 Primers of each target gene

Gene	Amplicon Size (bp)	Forward primer (5'→3')	Reverse primer (5'→3')
β-actin	150	CCCATCTATGAGGGTTACGC	TTTAATGTCACGCACGATTTC
Atg12	111	GCCTCGGAGCAGTTGTTTA	ATGTAGGACCAGTTTACCATCAC
Atg5	104	TCCAACGTGCTTTACTCTCTATC	TGTCAGTTACCAGCGTCAAATA
ULk1	126	ACAGCCTGCGCTTCACACTA	TCTGGTCAGCCACCACACTT
Atg3	138	GTGGCAGCTGGAGATCACTT	ACACCGCTTGTAGCATGGAA

Figure 1 Hematoxylin and eosin staining of the morphology of the synovium of the left hind limb joints of rats A: normal group; B: model group; C: moxibustion group; D: cigarette moxibustion group; E: medicine group. Normal group were not established of any model or treated with any intervention. Model group were established of rheumatoid arthritis model and treated without any intervention. Moxibustion group were established of rheumatoid arthritis model and treated with moxibustion for 15 d. Cigarette moxibustion group were established of rheumatoid arthritis model and treated with cigarette moxibustion for 15 d. Medicine group were established of rheumatoid arthritis model and treated with tripterygium glycoside (8 mg/kg per day) for 15 d. Black arrow heads synovium. Scale bar = 50 μm.

Table 2 Level of ESR, CRP, RF ($\bar{x}$ ± s)

Group	n	ESR (mm/h)	CRP (mg/L)	RF (ng/L)
Normal	8	3.3±1.0	4.3±1.6	26.2±6.8
Model	8	10.8±2.7^a	19.0±2.1^a	84.1±11.1^a
Moxibustion	8	7.1±1.9^b	12.1±2.6^b	52.5±6.7^b
Cigarette	8	10.2± 1.7^c	16.9±2.8^bd	73.6±8.9^d
Medicine	8	7.4±1.8^be	10.5±2.0^bf	44.1±5.3^bf

Table 3 Gene expression of autophagy process ($\bar{x}$ ± s)

Group	n	Atg3 mRNA	Atg5 mRNA	Atg12 mRNA	ULK1 mRNA
Normal	6	1.00±0.03	1.00±0.12	1.00±0.13	1.00±0.05
Model	6	0.35±0.03^a	0.42±0.04^a	0.49±0.04^a	0.32±0.04^a
Moxibustion	6	0.57±0.05^b	0.63±0.03^b	0.72±0.01^b	0.66±0.04^b
Cigarette	6	0.42±0.02^bd	0.52±0.02^c	0.61±0.03^cb	0.46±0.03^bd
Medicine	6	0.79±0.06^bde	0.73±0.02^be	0.78±0.02^be	0.77±0.05^bde

Figure 2 Key protein expression in the autophagy process A: images of Western blot; B1-B5: relative expression quantity of PI3K, Akt, mTOR, LC3-Ⅱ, Beclin-1. Normal group (Normal) were not established of any model or treated with any intervention. Model group (Model) were established of rheumatoid arthritis model and treated without any intervention. Moxibustion group (Moxibustion) were established of rheumatoid arthritis model and treated with moxibustion for 15 d. Cigarette moxibustion group (Cigarette) were established of rheumatoid arthritis model and treated with cigarette moxibustion for 15 d. Medicine group (Medicine) were established of rheumatoid arthritis model and treated with tripterygium glycoside (8 mg/kg per day) for 15 d. All values are mean ± standard deviation (n = 6). PI3K: phosphatidylinositol-3-kinase; Akt: protein kinase B; mTOR: mammalian target of rapamycin; LC3-Ⅱ: microtubule-associated protein light chain 3-Ⅱ. aP < 0.01, vs normal group; bP < 0.01, vs model group; cP < 0.01, vs moxibustion group; dP < 0.01, vs cigarette moxibustion group.

Figure 3 Expression levels of p-PI3K, p-Akt, p-mTOR A: images of Western blot; B1-B5: relative expression quantity of p-PI3K, p-Akt, p-mTOR. Normal group (Normal) were not established of any model or treated with any intervention. Model group (Model) were established of rheumatoid arthritis model and treated without any intervention. Moxibustion group (Moxibustion) were established of rheumatoid arthritis model and treated with moxibustion for 15 d. Cigarette moxibustion group (Cigarette) were established of rheumatoid arthritis model and treated with cigarette moxibustion for 15 d. Medicine group (Medicine) were established of rheumatoid arthritis model and treated with tripterygium glycoside (8 mg/kg per day) for 15 d. All values are mean ± standard deviation (n = 6). p-PI3K: phosphorylated phosphatidylinositol-3-kinase; p-Akt: phosphorylated protein kinase B; p-mTOR: phosphorylated mammalian target of rapamycin. aP < 0.01, vs normal group; bP < 0.01, vs model group; cP < 0.01, vs moxibustion group; dP < 0.01, vs cigarette moxibustion group.

Table 4 Serum levels of IL-4, IL-6, IL-10, IL-1β, TNF-α, IL-23, and IL-17 in rats (pg/mL, $\bar{x}$± s)

Group	n	IL-1β	IL-6	TNF-α	IL-10	IL-4	IL-17	IL-23
Normal	8	39.4±6.5	4.5±1.0	7.7±1.1	19.6±2.4	55.7±4.5	48.7±5.3	53.4±5.7
Model	8	69.5±7.5 ^a	12.9±1.6 ^a	14.0±2.4 ^a	5.9±1.1 ^a	28.5±3.0 ^a	68.2±5.8 ^a	68.3±4.1 ^a
Moxibustion	8	44.0±7.7 ^b	7.6±0.9 ^b	8.8±1.5 ^b	13.3±2.0 ^b	45.9±2.7 ^b	57.1±8.2 ^b	57.1±5.0 ^b
Cigarette	8	61.6±6.6 ^c	10.8±1.0 ^cb	12.9±2.2 ^c	6.1±1.4 ^c	30.0±2.1 ^c	62.6±7.5	67.1±3.9 ^c
Medicine	8	53.0±6.2 ^db	5.8±1.0 ^bce	8.6±1.2 ^be	9.9±1.2 ^bce	38.7±2.3 ^bce	63.3±8.7	66.5±4.3 ^c

References 52

[1]	Seca S, Patrício M, Kirch S, Franconi G, Cabrita AS, Greten HJ. Effectiveness of acupuncture on pain, functional disability, and quality of life in rheumatoid arthritis of the hand: results of a double-blind randomized clinical trial. J Altern Complement Med 2019;25:86-97.
[2]	Shen B, Sun Q, Chen H, et al. Effects of moxibustion on pain behaviors in patients with rheumatoid arthritis: a Meta-analysis. Medicine (Baltimore) 2019;98:e16413.
[3]	Zhang W, Chen M, Hu J. Long-snake moxibustion for rheumatoid arthritis: a randomized controlled trial. Zhong Guo Zhen Jiu 2016; 12; 36:694-8.
[4]	Feng FB, Qiu HY. Effects of Artesunate on chondrocyte proliferation, apoptosis and autophagy through the PI3K/AKT/mTOR signaling pathway in rat models with rheumatoid arthritis. Biomed Pharmacother 2018;102:1209-20.
[5]	Lin J, He Y, Wang B, et al. Blocking of YY1 reduce neutrophil infiltration by inhibiting IL-8 production via the PI3K-Akt-mTOR signaling pathway in rheumatoid arthritis. Clin Exp Immunol 2019;195:226-36.
[6]	Wu X, Long L, Liu J, et al. Gambogic acid suppresses inflammation in rheumatoid arthritis rats via PI3K/Akt/mTOR signaling pathway. Mol Med Rep 2017;16:7112-8.
[7]	Dai Y, Hu S. Recent insights into the role of autophagy in the pathogenesis of rheumatoid arthritis. Rheumatology (Oxford). 2016;55:403-10.
[8]	Yuan J, Hu L, Song XG, et al. Influence of moxibustion on TLR 4-MyD 88-NF-KB signal transduction pathway of synovial tissue in rheumatoid arthritis rats. Zhen Ci Yan Jiu 2015;40:199-204.
[9]	Yuan J, Hu L, Song XG, et al. Effect of moxibustion on Toll-like receptor 4-bone marrow differentiation factor 88-nuclear factor kappa B signal pathway in synovial tissue of rats with rheumatoid arthritis. Zhen Ci Yan Jiu 2015;40:199-204.
[10]	Zheng B, Hu L, Song X, et al. Analgesic effect of different moxibustion durations in rheumatoid arthritis rats. J Tradit Chin Med 2014;34:90-5.
[11]	Peng CY, Luo L, Hu L, et al. Effects of different doses of Freund's complete adjuvant on replication in rats with rheumatoid arthritis. Zhong Guo Yi Yao Zhi Nan 2012;10:90-5.
[12]	Lin WZ, Wang P. Experimental acupuncture. First Edition. Shanghai: Shanghai Science and Technology Press, 1999: 277-82.
[13]	Shahrabi S, Paridar M, Zeinvand-Lorestani M, et al. Autophagy regulation and its role in normal and malignant hematopoiesis. J Cell Physiol 2019;234:21746-57.
[14]	Mizushima N, Komatsu M. Autophagy: renovation of cells and tissues. Cell 2011; 11; 147:728-41.
[15]	Manganelli V, Recalchi S, Capozzi A, et al. Autophagy induces protein carbamylation in fibroblast-like synoviocytes from patients with rheumatoid arthritis. Rheumatology (Oxford). 2018;57:2032-41.
[16]	Kato M, Ospelt C, Gay RE, Gay S, Klein K. Dual role of autophagy in stress-induced cell death in rheumatoid arthritis synovial fibroblasts. Arthritis Rheumatol 2014;66:40-8.
[17]	Yin H, Wu H, Chen Y, et al. The therapeutic and pathogenic role of autophagy in autoimmune diseases. Front Immunol 2018; 31; 9:1512.
[18]	Qi Z, Chen L. Endoplasmic reticulum stress and autophagy. Adv Exp Med Biol 2019;1206:167-77.
[19]	Xu K, Xu P, Yao JF, Zhang YG, Hou WK, Lu SM. Reduced apoptosis correlates with enhanced autophagy in synovial tissues of rheumatoid arthritis. Inflamm Res 2013;62:229-37.
[20]	Vomero M, Barbati C, Colasanti T, et al. Autophagy and rheumatoid arthritis: current knowledges and future perspectives. Front Immunol 2018; 18; 9:1577.
[21]	Chen Y, He J, Tian M, et al. UNC51-like kinase 1, autophagic regulator and cancer therapeutic target. Cell Prolif 2014;47:494-505.
[22]	Park JM, Seo M, Jung CH, et al. ULK1 phosphorylates Ser30 of BECN1 in association with ATG14 to stimulate autophagy induction. Autophagy 2018;14:584-97.
[23]	Wu D, Hao Z, Ren H, Wang G. Loss of VAPB regulates autophagy in a Beclin 1-dependent manner. Neurosci Bull 2018;34:1037-46.
[24]	Hamurcu Z, Delibaşı N, Geçene S, et al. Targeting LC3 and Beclin-1 autophagy genes suppresses proliferation, survival, migration and invasion by inhibition of Cyclin-D1 and uPAR/Integrin β1/ Src signaling in triple negative breast cancer cells. J Cancer Res Clin Oncol 2018;144:415-30.
[25]	Li SP, He JD, Wang Z, et al. miR-30b inhibits autophagy to alleviate hepatic ischemia-reperfusion injury via decreasing the Atg12-Atg5 conjugate. World J Gastroenterol 2016;22:4501-14.
[26]	Otomo C, Metlagel Z, Takaesu G, Otomo T. Structure of the human ATG12-ATG5 conjugate required for LC3 lipidation in autophagy. Nat Struct Mol Biol 2013;20:59-66.
[27]	Khan MA, Jain VK, Rizwanullah M, Ahmad J, Jain K. PI3K/AKT/mTOR pathway inhibitors in triple-negative breast cancer: a review on drug discovery and future challenges. Drug Discov Today 2019;24:2181-91.
[28]	Zhang Y, Yan H, Xu Z, Yang B, Luo P, He Q. Molecular basis for class side effects associated with PI3K/AKT/mTOR pathway inhibitors. Expert Opin Drug Metab Toxicol 2019;15:767-74.
[29]	Barra F, Evangelisti G, Ferro Desideri L, et al. Investigational PI3K/AKT/mTOR inhibitors in development for endometrial cancer. Expert Opin Investig Drugs 2019;28:131-42.
[30]	Feng FB, Qiu HY. Effects of Artesunate on chondrocyte proliferation, apoptosis and autophagy through the PI3K/AKT/mTOR signaling pathway in rat models with rheumatoid arthritis. Biomed Pharmacother 2018;102:1209-20.
[31]	Darrieutort-Laffite C, Boutet MA, Chatelais M, et al. IL-1β and TNFα promote monocyte viability through the induction of GM-CSF expression by rheumatoid arthritis synovial fibroblasts. Mediators Inflamm 2014;2014:241840.
[32]	Li Y, Zhang W. IL-6: the next key target for rheumatoid arthritis after TNF-α. Sheng Wu Gong Cheng Xue Bao 2017; 25; 33:36-43.
[33]	Lin NY, Beyer C, Giessl A, et al. Autophagy regulates TNFα-mediated joint destruction in experimental arthritis. Ann Rheum Dis 2013;72:761-8.
[34]	Hashizume M, Hayakawa N, Mihara M. IL-6 trans-signalling directly induces RANKL on fibroblast-like synovial cells and is involved in RANKL induction by TNF-alpha and IL-17. Rheumatology (Oxford) 2008;47(11):1635-40.
[35]	Connor AM, Mahomed N, Gandhi R, Keystone EC, Berger SA. TNFα modulates protein degradation pathways in rheumatoid arthritis synovial fibroblasts. Arthritis Res Ther 2012; 14; 14:R62.
[36]	Fujimoto M, Serada S, Mihara M, et al. Interleukin-6 blockade suppresses autoimmune arthritis in mice by the inhibition of inflammatory Th17 responses. Arthritis Rheum 2008;58:3710-9.
[37]	Yuan N, Yu G, Liu D, Wang X, Zhao L. An emerging role of interleukin-23 in rheumatoid arthritis. Immunopharm Immunot 2019;41:185-91.
[38]	Kamel KM, Gad AM, Mansour SM, Safar MM, Fawzy HM. Novel anti-arthritic mechanisms of polydatin in complete Freund's adjuvant-induced arthritis in rats: involvement of IL-6, STAT-3, IL-17, and NF-кB. Inflammation 2018;41:1974-86.
[39]	Funaki Y, Hasegawa Y, Okazaki R, et al. Resolvin E1 inhibits osteoclastogenesis and bone resorption by suppressing IL-17-induced RANKL expression in osteoblasts and RANKL-induced osteoclast differentiation. Yonago Acta Med 2018; 28; 61:8-18.
[40]	Wei L, Xiong H, Li W, Li B, Cheng Y. Upregulation of IL-6 expression in human salivary gland cell line by IL-17 via activation of p38 MAPK, ERK, PI3K/Akt, and NF-κB pathways. J Oral Pathol Med 2018;47:847-55.
[41]	Li H, Min J, Mao X, Wang X, Yang Y, Chen Y. Edaravone ameliorates experimental autoimmune thyroiditis in rats through HO-1-dependent STAT3/PI3K/Akt pathway. Am J Transl Res 2018;10:2037-46.
[42]	Xiao Y, Shi M, Qiu Q, et al. Piperlongumine suppresses dendritic cell maturation by reducing production of reactive oxygen species and has therapeutic potential for rheumatoid arthritis. J Immunol 2016; 15; 196:4925-34.
[43]	Chen KH, Li RB, Li K, et al. Clinical effects of moxibustion treatment of rheumatoid arthritis and a study of its blood IL-6 and CRP levels. Zhong Yao Yao Li Yu Lin Chuang 2015;31:303-4.
[44]	Ouyang BS, Che JL, Gao J, et al. Effects of electroacupuncture and simple acupuncture on changes of IL-1, IL-4, IL-6 and IL-10 in peripheral blood and joint fluid in patients with rheumatoid arthritis. Zhong Guo Zhen Jiu 2010;30:840-4.
[45]	Verhoef CM, Van Roon JA, Vianen ME, Bijlsma JW, Lafeber FP. Interleukin 10 (IL-10), not IL-4 or interferon-gamma production, correlates with progression of joint destruction in rheumatoid arthritis. J Rheumatol 2001;28:1960-6.
[46]	Hong H, Zeng Y, Jian W, et al. CDK7 inhibition suppresses rheumatoid arthritis inflammatio via blockage of NF-κB activation and IL-1β/IL-6 secretion. J Cell Mol Med 2018;22:1292-301.
[47]	Ogata A, Kato Y, Higa S, Yoshizaki K. IL-6 inhibitor for the treatment of rheumatoid arthritis: a comprehensive review. Mod Rheumatol 2019;29:258-67.
[48]	Nguyen MVC, Baillet A, Romand X, et al. Prealbumin, platelet factor 4 and S100A12 combination at baseline predicts good response to TNF alpha inhibitors in rheumatoid arthritis. Joint Bone Spine 2019;86:195-201.
[49]	Wu X, Zhang Y, Chen B, Luo J, Gan L, Chen G. Moxibustion for rheumatoid arthritis: protocol for a systematic review. Medicine (Baltimore) 2019;98:e15899.
[50]	Jiang J, Wang X, Wu X, Yu Z. Analysis of factors influencing moxibustion efficacy by affecting heat-activated transient receptor potential vanilloid channels. J Tradit Chin Med 2016;36:255-60.
[51]	Zhang H, Ma XP, Wu HG, et al. Effect of moxibustion on tumor necrosis factor-α and nuclear transcription factor kappa B in ankle joints of rats with rheumatoid arthritis. J Acupunct Tuina Sci 2017;15:171-6.
[52]	Luo L, Hu L, Song XG, et al. Effect of moxibustion on th emetatarsal joint cytokine in rheumatoid arthritis rats. Huan Qiu Zhong Yi Yao 2011;4:416-9.

Home

Online First

Author Center

Reviewer Center

Issues

Announcement

About Us

Effect of moxibustion on autophagy and the inflammatory response of synovial cells in rheumatoid arthritis model rats

RichHTML

PDF

Knowledge

Abstract

Cite this article

share this article

Figures/Tables 7

References 52

Related Articles 15

Recommended Articles

Metrics

Comments

[1]	LI Xi, LIN Xiangquan, CHEN Dongdong, LIU Hui. B-cell lymphoma-2 phosphorylation at Ser70 site-related autophagy mediates puerarin-inhibited the apoptosis of MC3T3-E1 cells during osteoblastogenesis [J]. Journal of Traditional Chinese Medicine, 2024, 44(1): 27-34.
[2]	DU Zhongheng, CONG Wenjie, TANG Kejing, ZHENG Qiqi, SONG Zhiwei, CHEN Yong, YANG Su, ZHANG Chunwu, YE Tianshen. Electroacupuncture stimulating Zusanli (ST36), Sanyinjiao (SP6) in mice with collagen-induced arthritis leads to adenosine A2A receptor-mediated alteration of p38α mitogen-activated protein kinase signaling and inhibition of osteoclastogenesis [J]. Journal of Traditional Chinese Medicine, 2023, 43(6): 1103-1109.
[3]	LI Chaoran, YANG Yan, FENG Chuwen, LI Heng, QU Yuanyuan, WANG Yulin, WANG Delong, WANG Qingyong, GUO Jing, SHI Tianyu, SUN Xiaowei, WANG Xue, HOU Yunlong, SUN Zhongren, YANG Tiansong. Integrated 'omics analysis for the gut microbiota response to moxibustion in a rat model of chronic fatigue syndrome [J]. Journal of Traditional Chinese Medicine, 2023, 43(6): 1176-1189.
[4]	WANG Miao, ZHU Yan, ZHAO Hui, ZHAO Hongfang. Moxibustion enables protective effects on rheumatoid arthritis-induced myocardial injury via transforming growth factor beta1 signaling and metabolic reprogramming [J]. Journal of Traditional Chinese Medicine, 2023, 43(6): 1190-1199.
[5]	JIANG Jianzhen, ZHANG Xin, LUO Zhenguo, SU Chengguo, ZHOU Haiyan, JIANG Yuqing, XIAO Xianjun, CHEN Yunfei, ZHU Jun. Efficacy of electroacupuncture stimulating Zusanli (ST36) and Xuanzhong (GB39) on synovial angiogenesis in rats with adjuvant arthritis [J]. Journal of Traditional Chinese Medicine, 2023, 43(5): 955-962.
[6]	DING Luobin, WANG Huajun, LI Yao, LI Jia, LI Ling, GAO Yangping, GUAN Jian, GENG Weiqiang. Electroacupuncture stimulating Neixiyan (EX-LE5) and Dubi (ST35) alleviates osteoarthritis in rats induced by anterior cruciate ligament transaction via affecting DNA methylation regulated transcription of miR-146a and miR-140-5p [J]. Journal of Traditional Chinese Medicine, 2023, 43(5): 983-990.
[7]	GUO Zhaoan, SUN Lina, LIU Yingying, LI Ruifeng, LIU Chong, DIAO Ke, SHI Jing, SUN Jun. Qizhi Jiangtang capsule (芪蛭降糖胶囊) activates podocyte autophagy in diabetic kidney disease by inhibiting phosphatidylinositol 3-kinase/protein kinase B/mammalian target of rapamycin pathways [J]. Journal of Traditional Chinese Medicine, 2023, 43(4): 667-675.
[8]	Chen Xilin, GUO Yan, LU Juan, QIN Luxue, HU Tingyao, ZENG Xin, WANG Xinyue, ZHANG Anran, ZHUANG Yuxin, ZHONG Honggang, GUO Changqing. Acupotomy ameliorates subchondral bone absorption and mechanical properties in rabbits with knee osteoarthritis by regulating bone morphogenetic protein 2-Smad1 pathway [J]. Journal of Traditional Chinese Medicine, 2023, 43(4): 734-743.
[9]	Minh Duc Nguyen, Thanh Van Tran, Quoc Vinh Nguyen, Cay Doan Ha, Linh Vu Phuong Dang. Effectiveness of bee venom acupuncture for patients suffering from periarthritis humeroscapularis [J]. Journal of Traditional Chinese Medicine, 2023, 43(4): 795-800.
[10]	LI Xingjie, LIU Qiqi, XIA Rui, LIU Jun, WANG Dan, SHI Jiao, KUANG Yuxing, DAI Yalan, HUANG Haoyu, TANG Wei, CHEN Shangjie. Moxibustion modulates working memory in patients with amnestic mild cognitive impairment: a functional magnetic resonance imaging study [J]. Journal of Traditional Chinese Medicine, 2023, 43(4): 801-808.
[11]	MA Fangfang, ZHANG Hewei, LI Bingxue, CHENG Peiyu, YU Mingwei, WANG Xiaomin. Acupuncture and moxibustion for malignant tumor patients with psychological symptoms of insomnia, anxiety and depression: a systematic review and Meta-analysis [J]. Journal of Traditional Chinese Medicine, 2023, 43(3): 441-456.
[12]	WU Haiyang, WANG Ying, HAN Wei, LI Huihui, JI Haisheng, LIU Xiuxiu. Protective effect of Tongdu Tiaoshen acupuncture combined with Xiaoxuming decoction (小续命汤) on dopaminergic neurons in Parkinson’s disease model [J]. Journal of Traditional Chinese Medicine, 2023, 43(3): 484-493.
[13]	GUO Zhuang, WANG Junwen, LI Zhonglong, CHEN Zhongjie, CHEN Li, YAN Shiyan, LU Hongrong, LI Zhigeng, LI Guanying. Protocol to establish auxiliary diagnostic model for knee osteoarthritis functional testing equipment [J]. Journal of Traditional Chinese Medicine, 2023, 43(2): 379-385.
[14]	MIN Youjiang, YAO Haihua, WANG Zhiqin, LUO Kaitao, SUN Jie, YUAN Zheng, WU Huiqi, CHENG Lihong. Efficacy of suspended moxibustion stimulating Shenshu (BL23) and Guanyuan (CV4) on the amygdala-HPA axis in rats with kidney-Yang deficiency symptom pattern induced by hydrocortisone [J]. Journal of Traditional Chinese Medicine, 2023, 43(1): 113-123.
[15]	YAO Yao, ZHAO Zhenni, CHEN Fengqin, LENG Yufei, PANG Xiangtian, XU Xiao, SUN Zhiling. Effectiveness of moxibustion alone on lumbar disc herniation: a Meta-analysis of randomized controlled trials [J]. Journal of Traditional Chinese Medicine, 2023, 43(1): 14-26.