Shenweifang-containing serum inhibits transforming growth factor-β1-induced myofibroblast differentiation in normal rat kidney interstitial fibroblast cells

doi:10.19852/j.cnki.jtcm.2022.01.004

Abstract

Abstract:

OBJECTIVE: To investigate the efficacy of Shenweifang (SWF)-containing serum on transforming growth factor (TGF)-β1-induced fibroblast-myofibroblast transition in normal rat kidney interstitial fibroblast cells (NRK-49F).

METHODS: Sprague-Dawley rats were gavaged with one of five solutions: (a) saline; (b) saline plus low-dose SWF; (c) saline plus medium-dose SWF; (d) saline plus high-dose SWF; and (e) saline plus valsartan. NRK-49F cells were treated with TGF-β1 and cultured using serum from the gavaged rats.

RESULTS: TGF-β1 treatment increased the expression of α-smooth muscle actin, proliferating cell nuclear antigen, collagenⅠ, Smad3, mitogen-activated protein kinase (MAPK) 10, and c-Jun N-terminal kinase (JNK) 3 and induced abnormalities in cell morphology, cell cycle progression, and cell proliferation.

CONCLUSIONS: SWF- or valsartan-containing serum corrected (or partially corrected) TGF-β1-induced abnormal changes in this in vitro system. SWF-containing serum reversed abnormalities in morphology, cell cycle progression, and proliferation in TGF-β1-treated NRK-49F cells, probably by blocking the TGF-β1/Smads and TGF-β1/MAPK/JNK pathways.

Key words: fibrosis, transforming growth factor beta1, Smad proteins, mitogen-activated protein kinases, JNK mitogen-activated protein, kinases drug-containing serum, Shenweifang

Jiaru LIN, Li WANG, Bo CHEN, Santao OU, Jianhua QIN, Junming FAN. Shenweifang-containing serum inhibits transforming growth factor-β1-induced myofibroblast differentiation in normal rat kidney interstitial fibroblast cells[J]. Journal of Traditional Chinese Medicine, 2022, 42(1): 39-48.

Figures/Tables 7

Table 1 Primers used in real-time polymerase chain reaction

Gene	Forward primer/reverse primer
α-SMA	F: 5'-CAGGGAGTGATGGTTGGAAT-3'
	R: 5'-GGTGATGATGCCGTGTTCTA-3'
Collagen Ⅰ	F: 5'TCCGACCTCTCTCCTCTGAA3'
	R: 5'TGCTTTGTGCTTTGGGAAGT3'
Fibronectin	F: 5'AGGAGAACCAGGAGAGCACA3'
	R: 5'TCGGTCACTTCCACAAACTG3'
PCNA	F: 5'ATCCTGAAGAAGGTGCTGGA3'
	R: 5'GCTGCACTAAGGAGACGTGA3'
Samd3	F: 5' CTATGATGTCAAGTGCGTGCTG3'
	R: 5'CGTTGTACTGCTGGGTGGTG3'
MAPK10	F: 5'TGCCAAGAGGGCTTACCG3'
	R: 5'GCGTCCATCAGTTCCATCAC3'
GAPDH	F: 5'ATCCCATCACCATCTTCCAG3'
	R: 5'CCATCACGCCACAGTTTCC3'

Figure 1 Effect of Shenweifang (SWF)-containing serum on the cell cycle distribution of transforming growth factor (TGF)-β1-treated normal rat kidney interstitial fibroblast cells (NRK-49F) As A and B shows control group, untreated cells (cultured in 10% fetal bovine serum). TGF-β1 group, cells treated with TGF-β1 (10 ng/mL) and 10% normal rat serum (rats were gavaged saline). Low-dose SWF+TGF-β1 group, cells treated with TGF-β1 (10 ng/mL) and 10% low-dose SWF rat serum (rats were gavaged low-dose SWF). Medium-dose SWF+TGF-β1 group, cells treated with TGF-β1 (10 ng/mL) and 10% medium-dose SWF rat serum (rats were gavaged medium-dose SWF). High-dose SWF+TGF-β1 group, cells treated with TGF-β1 (10 ng/mL) and 10% high-dose SWF rat serum (rats were gavaged high-dose SWF). Valsartan serum+TGF-β1 group, cells treated with TGF-β1 (10 ng/mL) and 10% valsartan-containing rat serum (rats were gavaged valsartan). n = 3. aP ˂ 0.01 compared with control cells; bP < 0.01 compared with TGF-β1-treated cells.

Figure 2 Effect of Shenweifang (SWF)-containing serum on the protein expression of α-smooth muscle actin (α-SMA), fibronectin, and proliferating cell nuclear antigen (PCNA) in transforming growth factor (TGF)-β1-treated normal rat kidney interstitial fibroblast cells (NRK-49F) Control group, untreated cells (cultured in 10% fetal bovine serum). TGF-β1 group, cells treated with TGF-β1 (10 ng/mL) and 10% normal rat serum (rats were gavaged saline). Low-dose SWF+TGF-β1 group, cells treated with TGF-β1 (10 ng/mL) and 10% low-dose-SWF rat serum (rats were gavaged low-dose SWF). Medium-dose SWF+TGF-β1 group, cells treated with TGF-β1 (10 ng/mL) and 10% medium-dose-SWF rat serum (rats were gavaged medium-dose SWF). High-dose SWF + TGF-β1 group, cells treated with TGF-β1 (10 ng/mL) and 10% high-dose-SWF rat serum (rats were gavaged high-dose SWF). Valsartan serum + TGF-β1 group, cells treated with TGF-β1 (10 ng/mL) and 10% valsartan-containing rat serum (rats were gavaged valsartan).

Figure 3 Effect of Shenweifang (SWF)-containing serum on the mRNA expression of α-smooth muscle actin (α-SMA), fibronectin, proliferating cell nuclear antigen (PCNA), and collagen Ⅰ in transforming growth factor (TGF)-β1-treated NRK-49F cells A: α-SMA; B: fibronectin; C: PCNA; D: collagen Ⅰ. Control group, untreated cells (cultured in 10% fetal bovine serum). TGF-β1 group, cells treated with TGF-β1 (10 ng/mL) and 10% normal rat serum (rats were gavaged saline). Low-dose SWF+TGF-β1 group, cells treated with TGF-β1 (10 ng/mL) and 10% low-dose SWF rat serum (rats were gavaged low-dose SWF). Medium-dose SWF + TGF-β1 group, cells treated with TGF-β1 (10 ng/mL) and 10% medium-dose SWF rat serum (rats were gavaged medium-dose SWF). High-dose SWF + TGF-β1 group, cells treated with TGF-β1 (10 ng/mL) and 10% high-dose SWF rat serum (rats were gavaged high-dose SWF). Valsartan serum + TGF-β1 group, cells treated with TGF-β1 (10 ng/mL) and 10% valsartan-containing rat serum (rats were gavaged valsartan). n = 3. aP ˂ 0.01, compared with control cells; bP < 0.01, compared with TGF-β1-treated cells. SWF: Shenweifang; α-SMA: α-smooth muscle actin; PCNA: proliferating cell nuclear antigen; TGF-β1: transforming growth factor-β1.

Figure 4 Effect of Shenweifang (SWF)-containing serum on the mRNA expression of Smad3 and MAPK-10 in transforming growth factor (TGF)-β1-treated NRK-49F cells Control group, untreated cells (cultured in 10% fetal bovine serum). TGF-β1 group, cells treated with TGF-β1 (10 ng/mL) and 10% normal rat serum (rats were gavaged saline). Low-dose SWF+TGF-β1 group, cells treated with TGF-β1 (10 ng/mL) and 10% low-dose SWF rat serum (rats were gavaged low-dose SWF). Medium-dose SWF+TGF-β1 group, cells treated with TGF-β1 (10 ng/mL) and 10% medium-dose SWF rat serum (rats were gavaged medium-dose SWF). High-dose SWF+TGF-β1 group, cells treated with TGF-β1 (10 ng/mL) and 10% high-dose-SWF rat serum (rats were gavaged high-dose SWF). Valsartan serum+TGF-β1 group, cells treated with TGF-β1 (10 ng/mL) and 10% valsartan-containing rat serum (rats were gavaged valsartan). n = 3. aP ˂ 0.01, compared with control cells; bP < 0.01, cP < 0.05, compared with TGF-β1-treated cells.

Figure 5 Effect of Shenweifang (SWF)-containing serum on the protein expression of α-smooth muscle actin (α-SMA), fibronectin, proliferating cell nuclear antigen (PCNA), and collagen Ⅰ in transforming growth factor (TGF)-β1-treated NRK-49F cells Control group, untreated cells (cultured in 10% fetal bovine serum). TGF-β1 group, cells treated with TGF-β1 (10 ng/mL) and 10% normal rat serum (rats were gavaged saline). Low-dose SWF+TGF-β1 group (low-dose group), cells treated with TGF-β1 (10 ng/mL) and 10% low-dose SWF rat serum (rats were gavaged low-dose SWF). Medium-dose SWF+TGF-β1 group (medium-dose group), cells treated with TGF-β1 (10 ng/mL) and 10% medium-dose SWF rat serum (rats were gavaged medium-dose SWF). High-dose SWF+TGF-β1 group (high-dose group), cells treated with TGF-β1 (10 ng/mL) and 10% high-dose SWF rat serum (rats were gavaged high-dose SWF). Valsartan serum+TGF-β1 group (Val group), cells treated with TGF-β1 (10 ng/mL) and 10% valsartan-containing rat serum (rats were gavaged valsartan). n = 3. aP ˂ 0.01, compared with control cells; bP < 0.01, cP < 0.05, compared with TGF-β1-treated cells.

Figure 6 Effect of Shenweifang (SWF)-containing serum on the protein expression of Smad2/3, phosphorylated Smad3 (p-Smad3), c-Jun N-terminal kinase (JNK), and JNK-3 in transforming growth factor (TGF)-β1-treated NRK-49F cells Control group, untreated cells (cultured in 10% fetal bovine serum). TGF-β1 group, cells treated with TGF-β1 (10 ng/mL) and 10% normal rat serum (rats were gavaged saline). Low-dose SWF+TGF-β1 group, cells treated with TGF-β1 (10 ng/mL) and 10% low-dose SWF rat serum (rats were gavaged low-dose SWF). Medium-dose SWF+TGF-β1 group, cells treated with TGF-β1 (10 ng/mL) and 10% medium-dose SWF rat serum (rats were gavaged medium-dose SWF). High-dose SWF+TGF-β1 group, cells treated with TGF-β1 (10 ng/mL) and 10% high-dose SWF rat serum (rats were gavaged high-dose SWF). Valsartan serum+TGF-β1 group, cells treated with TGF-β1 (10 ng/mL) and 10% valsartan-containing rat serum (rats were gavaged valsartan). n = 3. aP ˂ 0.01, compared with control cells; bP < 0.05, cP < 0.01, compared with TGF-β1-treated cells.

References 41

[1]	Webster AC, Nagler EV, Morton RL, Masson P. Chronic kidney disease. Lancet 2017;389:1238-52.
[2]	Lane BR, Demirjian S, Derweesh IH, Riedinger CB, Fergany AF, Campbell SC. Is all chronic kidney disease created equal? Curr Opin Urol 2014;24:127-34.
[3]	Abubakar I, Tillmann T, Banerjee A. Global, regional, and national age-sex specific all-cause and cause-specific mortality for 240 causes of death, 1990-2013: a systematic analysis for the Global Burden of Disease Study 2013. Lancet 2015;385:117-71.
[4]	Levey A, Atkins R, Coresh J, et al. Chronic kidney disease as a global public health problem: approaches and initiatives-a position statement from Kidney Disease Improving Global Outcomes. Kidney Int 2007;72:247-59.
[5]	Foundation NK. KDOQI clinical practice guideline for diabetes and CKD: 2012 update. Am J Kidney Dis 2012;60:850-86.
[6]	Campanholle G, Ligresti G, Gharib SA, Duffield JS. Cellular mechanisms of tissue fibrosis. 3. Novel mechanisms of kidney fibrosis. Am J Physiol Cell Physiol 2013;304:C591-C603.
[7]	Fan J-M, Ng Y-Y, Hill PA, Nikolic-Paterson DJ, Mu W, Atkins RC, et al. Transforming growth factor-β regulates tubular epithelial-myofibroblast transdifferentiation in vitro. Kidney Int 1999;56:1455-67.
[8]	Lan HY. Diverse roles of TGF-β/Smads in renal fibrosis and inflammation. Int J Biol Sci 2011;7:1056.
[9]	Qin W, Chung AC, Huang XR, et al. TGF-β/Smad3 signaling promotes renal fibrosis by inhibiting miR-29. J Am Soc Nephrol 2011;22:1462-74.
[10]	Meng X-M, Chung AC, Lan HY. Role of the TGF-β/BMP-7/Smad pathways in renal diseases. Clin Sci 2013;124:243-54.
[11]	Meng XM, Huang XR, Chung AC, et al. Smad2 protects against TGF-β/Smad3-mediated renal fibrosis. J Am Soc Nephrol 2010;21:1477-87.
[12]	Ihn H. Pathogenesis of fibrosis: role of TGF-β and CTGF. Curr Opin Rheumatol 2002;14:681-5.
[13]	Leask A, Abraham DJ. TGF-β signaling and the fibrotic response. FASEB J 2004;18:816-27.
[14]	Biernacka A, Dobaczewski M, Frangogiannis NG. TGF-β signaling in fibrosis. Growth Factors 2011;29:196-202.
[15]	Nagai A, Shibamoto Y, Ogawa K. Therapeutic effects of saireito (Chai-Ling-Tang), a traditional Japanese herbal medicine, on lymphedema caused by radiotherapy: a case series study. Evid Based Complement Alternat Med 2013; 2013: 241629:1-6.
[16]	Chen Y, Deng Y, Ni Z, et al. Efficacy and safety of traditional chinese medicine (Shenqi particle) for patients with idiopathic membranous nephropathy: a multicenter randomized controlled clinical trial. Am J Kidney Dis 2013;62:1068-76.
[17]	Zhang J, Xie X, Li C, Fu P. Systematic review of the renal protective effect of Astragalus membranaceus (root) on diabetic nephropathy in animal models. J Ethnopharmacol 2009;126:189-96.
[18]	Wei Y, Fan J, Pan L. Effect of Panax notoginseng saponins on human kidney fibroblast. Zhong Guo Zhong Xi Yi Jie He Za Zhi 2002;22:47-9.
[19]	Xie X, Ping F, Liu X, Fan J, He C. Chinese medicine preventes the progression of chronic renal failure: clinical and molecular biology characteristics. Zhong Guo Lin Chuang Kang Fu Zazhi 2006;10:136-8.
[20]	Wang JL, Chen CW, Tsai MR, et al. Antifibrotic role of PGC-1α-siRNA against TGF-β1-induced renal interstitial fibrosis. Exp Cell Res 2018;370:160-7.
[21]	Suzuki H, Kanno Y, Sugahara S, Okada H, Nakamoto H. Effects of an angiotensin Ⅱ receptor blocker, valsartan, on residual renal function in patients on CAPD. Am J Kidney Dis 2004;43:1056-64.
[22]	Wu WP, Chang CH, Chiu YT, et al. A reduction of unilateral ureteral obstruction-induced renal fibrosis by a therapy combining valsartan with aliskiren. Am J Physiol-Renal 2010;299:F929-41.
[23]	Tang L, Yi R, Yang B, Li H, Chen H, Liu Z. Valsartan inhibited HIF-1α pathway and attenuated renal interstitial fibrosis in streptozotocin-diabetic rats. Diabetes Res Clin Pract 2012;97:125-31.
[24]	Lü LL, Liu BC. Role of non-classical renin-angiotensin system axis in renal fibrosis. Front Physiol 2015;6.
[25]	Liu X, Wang J, Lu Q. Inhibitory mechanism of Ginkgo giloba extract, captopril, and valsartan on kidney fibrosis of diabetic nephropathy rats and their comparison. Zhong Cao Yao 2008;39:560.
[26]	Liu Y. Cellular and molecular mechanisms of renal fibrosis. Nat Rev Nephrol 2011;7:684-96.
[27]	Verrecchia F, Chu M-L, Mauviel A. Identification of novel TGF-β/Smad gene targets in dermal fibroblasts using a combined cDNA microarray/promoter transactivation approach. J Biol Chem 2001;276:17058-62.
[28]	Sato M, Muragaki Y, Saika S, Roberts AB, Ooshima A. Targeted disruption of TGF-β1/Smad3 signaling protects against renal tubulointerstitial fibrosis induced by unilateral ureteral obstruction. J Clin Invest 2003;112:1486.
[29]	Flanders KC, Sullivan CD, Fujii M, et al. Mice lacking Smad3 are protected against cutaneous injury induced by ionizing radiation. Am J Pathol 2002;160:1057-68.
[30]	Zhou L, Fu P, Huang XR, Liu F, et al. Mechanism of chronic aristolochic acid nephropathy: role of Smad3. Am J Physiol-Renal 2010;298:F1006-17.
[31]	Bonniaud P, Kolb M, Galt T, et al. Smad3 null mice develop airspace enlargement and are resistant to TGF-β-mediated pulmonary fibrosis. J Immunol 2004;173:2099-108.
[32]	Fujimoto M, Maezawa Y, Yokote K, et al. Mice lacking Smad3 are protected against streptozotocin-induced diabetic glome-rulopathy. Biochem Biophys Res Commun 2003;305:1002-7.
[33]	Isono M, Chen S, Hong SW, Iglesias-de la Cruz MC, Ziyadeh FN. Smad pathway is activated in the diabetic mouse kidney and Smad3 mediates TGF-β-induced fibronectin in mesangial cells. Biochem Biophys Res Commun 2002;296:1356-65.
[34]	Liu Z, Huang XR, Lan HY. Smad3 mediates ANG Ⅱ-induced hypertensive kidney disease in mice. Am J Physiol-Renal 2012;302:F986-97.
[35]	Yang F, Chung AC, Huang XR, Lan HY. Angiotensin Ⅱ induces connective tissue growth factor and collagen Ⅰ expression via transforming growth factor-β-dependent and-independent smad pathways. Hypertension 2009;54:877-84.
[36]	Gao P, Wei Y, Zhang Z, et al. Synergistic effects of c-Jun and SP1 in the promotion of TGFβ1-mediated diabetic nephropathy progression. Exp Mol Pathol 2016;100:441-50.
[37]	Macia MS, Halbritter J, Delous M, et al. Mutations in MAPKBP1 cause juvenile or late-onset cilia-independent nephronophthisis. Am J Hum Genet 2017;100:323-33.
[38]	Hung TW, Tsai JP, Lin SH, Lee CH, Hsieh YH, Chang HR. Pentraxin 3 activates JNK signaling and regulates the Epithelial-To-Mesenchymal transition in renal fibrosis. Cell Physiol Biochem 2016;40:1029-38.
[39]	Ren M, Zhang J, Wang B, et al. Qindan-capsule inhibits proliferation of adventitial fibroblasts and collagen synthesis. J Ethnopharmacol 2010;129:53-8.
[40]	Li JX, Wang ZB, Zhu LQ, Niu FL, Cui W. Effects of Radix notoginseng extracts drug-containing serum on expressions of Bcl-2, Bax and p21WAF1 proteins in MNNG transformed GES-1 cells. Zhong Xi Yi Jie He Xue Bao 2008;6:817-20.
[41]	Wang QL, Yuan JL, Tao YY, Zhang Y, Liu P, Liu CH. Fuzheng Huayu recipe and vitamin E reverse renal interstitial fibrosis through counteracting TGF-β1-induced epithelial-to-mesen-chymal transition. J Ethnopharmacol 2010;127:631-40.

Home

Online First

Author Center

Reviewer Center

Issues

Announcement

About Us