Journal of Traditional Chinese Medicine ›› 2023, Vol. 43 ›› Issue (3): 474-483.DOI: 10.19852/j.cnki.jtcm.20220507.001
Previous Articles Next Articles
WANG Tianqi, LI Zining, CHEN Ting, CHEN Rui, JIN Ya, Oduro Patrick kwabena, ZHANG Han, WANG Yi(
)
Received:2021-12-11
Accepted:2022-04-29
Online:2023-06-15
Published:2022-05-07
Contact:
Prof. WANG Yi, Institute of Traditional Chinese Medicine, Tianjin University of Traditional Chinese Medicine, Tianjin 301617, China. vip_wangyi@126.com. Telephone: + 86-18920597172
Supported by:WANG Tianqi, LI Zining, CHEN Ting, CHEN Rui, JIN Ya, Oduro Patrick kwabena, ZHANG Han, WANG Yi. Zuogui (左归丸) and Yougui pills (右归丸) improve perimenopausal syndrome via regulation of apoptosis in mice[J]. Journal of Traditional Chinese Medicine, 2023, 43(3): 474-483.
| Chinese Name | Latin Name | English Name | Weight (g) |
|---|---|---|---|
| Shudihuang | Radix Rehmanniae Praeparata | Rehmanniae Radix Praeparata | 24 |
| Shanyao | Rhizoma Dioscoreae Oppositae | Dioscoreae Rhizoma | 10 |
| Gouqizi | Fructus Lycii | Lycii Fructus | 12 |
| Shanzhuyu | Fructus Corni | Corni Fructus | 12 |
| Chuanniuxi | Radix Cyathulae | Cyathulae Radix | 9 |
| Tusizi | Semen Cuscutae | Cuscutae Semen | 12 |
| Lujiaojiao | Colla Cornus Cervi | Cervicornuscolla | 12 |
| Guijiajiao | Colla Carapacis et Plastri | Testudinis Carapacis Et Plastri Colla | 12 |
Table 1 Medicinal materials of ZGP Chinese medical formulae
| Chinese Name | Latin Name | English Name | Weight (g) |
|---|---|---|---|
| Shudihuang | Radix Rehmanniae Praeparata | Rehmanniae Radix Praeparata | 24 |
| Shanyao | Rhizoma Dioscoreae Oppositae | Dioscoreae Rhizoma | 10 |
| Gouqizi | Fructus Lycii | Lycii Fructus | 12 |
| Shanzhuyu | Fructus Corni | Corni Fructus | 12 |
| Chuanniuxi | Radix Cyathulae | Cyathulae Radix | 9 |
| Tusizi | Semen Cuscutae | Cuscutae Semen | 12 |
| Lujiaojiao | Colla Cornus Cervi | Cervicornuscolla | 12 |
| Guijiajiao | Colla Carapacis et Plastri | Testudinis Carapacis Et Plastri Colla | 12 |
| Chinese Name | Latin Name | English Name | Weight (g) |
|---|---|---|---|
| Shudihuang | Radix Rehmanniae Praeparata | Rehmanniae Radix Praeparata | 24 |
| Rougui | Cortex Cinnamomi Cassiae | Cinnamomi Cortex | 6 |
| Shanzhuyu | Fructus Corni | Corni Fructus | 9 |
| Lujiaojiao | Colla Cornus Cervi | Cervicornuscolla | 12 |
| Danggui | Radix Angelicae Sinensis | Angelicae Sinensis Radix | 9 |
| Fuzi | Radix Aconiti Lateralis Preparata | Aconiti Lateralis Radix Praep Arata | 6 |
| Shanyao | Rhizoma Dioscoreae Oppositae | Dioscoreae Rhizoma | 12 |
| Tusizi | Semen Cuscutae | Cuscutae Semen | 12 |
| Gouqizi | Fructus Lycii | Lycii Fructus | 12 |
| Duzhong | Cortex Eucommiae | Eucommiae Cortex | 12 |
Table 2 Medicinal materials of YGP Chinese medical formulae
| Chinese Name | Latin Name | English Name | Weight (g) |
|---|---|---|---|
| Shudihuang | Radix Rehmanniae Praeparata | Rehmanniae Radix Praeparata | 24 |
| Rougui | Cortex Cinnamomi Cassiae | Cinnamomi Cortex | 6 |
| Shanzhuyu | Fructus Corni | Corni Fructus | 9 |
| Lujiaojiao | Colla Cornus Cervi | Cervicornuscolla | 12 |
| Danggui | Radix Angelicae Sinensis | Angelicae Sinensis Radix | 9 |
| Fuzi | Radix Aconiti Lateralis Preparata | Aconiti Lateralis Radix Praep Arata | 6 |
| Shanyao | Rhizoma Dioscoreae Oppositae | Dioscoreae Rhizoma | 12 |
| Tusizi | Semen Cuscutae | Cuscutae Semen | 12 |
| Gouqizi | Fructus Lycii | Lycii Fructus | 12 |
| Duzhong | Cortex Eucommiae | Eucommiae Cortex | 12 |
| Group | Dose (g/kg) | |||
|---|---|---|---|---|
| ZGP | YGP | EV | GNA | |
| Low-dose ZGP | 2.4 | - | - | - |
| Medium-dose ZGP | 4.8 | - | - | - |
| High-dose ZGP | 9.6 | - | - | - |
| Low-dose YGP | - | 3.6 | - | - |
| Medium-dose YGP | - | 7.2 | - | - |
| High-dose YGP | - | 14.4 | - | - |
| Low-dose ZGP+YGP | 1.2 | 1.8 | - | - |
| Medium-dose ZGP+YGP | 2.4 | 3.6 | - | - |
| High-dose ZGP+YGP | 4.8 | 7.2 | - | - |
| EV | - | - | 1.3×10-4 | - |
| GNA | - | - | - | 0.73 |
Table 3 Drug dose of each group
| Group | Dose (g/kg) | |||
|---|---|---|---|---|
| ZGP | YGP | EV | GNA | |
| Low-dose ZGP | 2.4 | - | - | - |
| Medium-dose ZGP | 4.8 | - | - | - |
| High-dose ZGP | 9.6 | - | - | - |
| Low-dose YGP | - | 3.6 | - | - |
| Medium-dose YGP | - | 7.2 | - | - |
| High-dose YGP | - | 14.4 | - | - |
| Low-dose ZGP+YGP | 1.2 | 1.8 | - | - |
| Medium-dose ZGP+YGP | 2.4 | 3.6 | - | - |
| High-dose ZGP+YGP | 4.8 | 7.2 | - | - |
| EV | - | - | 1.3×10-4 | - |
| GNA | - | - | - | 0.73 |
| Gene name | Forward primers | Reverse primers |
|---|---|---|
| β-actin | CCTCTATGCCAACACAGTGC | GTACTCCTGCTTGCTGATCC |
| Bcl-2 | TCCTTCCAGCCTGAGAGCAACC | TCACGACGGTAGCGACGAGAG |
| Bax | CGTGAGCGGCTGCTTGTCTG | ATGGTGAGCGAGGCGGTGAG |
| Caspase-3 | GCTTCTTCAGAGGCGACTACTGC | GCAAGCCATCTCCTCATCAGTCC |
Table 4 Sequences of amplification primers used
| Gene name | Forward primers | Reverse primers |
|---|---|---|
| β-actin | CCTCTATGCCAACACAGTGC | GTACTCCTGCTTGCTGATCC |
| Bcl-2 | TCCTTCCAGCCTGAGAGCAACC | TCACGACGGTAGCGACGAGAG |
| Bax | CGTGAGCGGCTGCTTGTCTG | ATGGTGAGCGAGGCGGTGAG |
| Caspase-3 | GCTTCTTCAGAGGCGACTACTGC | GCAAGCCATCTCCTCATCAGTCC |
Figure 1 4-VCD induces PMS in mice HE staining of vaginal cytology (magnification, ×200). A-D: vaginal cytology of control mice (A) in estrus, (B) in pro-estrus, (C) in diestrus, and (D) in late estrus, and 4-VCD-induced mice (E) in diestrus and (F) late estrus.. The control mice were injected with saline for 15 d (n = 15), the 4-VCD-induced mice were injected with 4-VCD intraperitoneally (160 mg·kg?1·d?1) for 15 d to induce PMS (n = 195). 4-VCD: 4-vinyl cyclohexene diepoxide; PMS: perimenopausal syndrome; HE: hematoxylin-eosin.
Figure 2 ZGP and YGP improve uterus structure and function in 4-VCD-induced PMS mice Uterus and (B) ovary indexes were computed after measuring individual weights of uterus and ovary treated with different concentrations of the indicated treatments in 4-VCD-induced PMS mice. A1, B1: the ZGP groups uterus and ovary indexes; A2, B2: the YGP groups uterus and ovary indexes; A3, B3: the ZGP+YGP groups uterus and ovary indexes; C: mice pretreated with 4-VCD were treated with different concentrations of the indicated drugs, and then uterus tissues were stained HE. Endometrium thickness (magnification, ×400); D: uterine glands features (magnification, ×400) are indicated by black arrows. C1, D1: the control mice received daily oral gavage of CMC-Na 0.5% solution; C2, D2: the model mice received daily oral gavage of CMC-Na 0.5% solution; C3-C5, D3-D5: the ZGP groups treated with ZGP (2.4, 4.8, and 9.6 g/kg); C6, D6: the EV group treated with EV (1.3 × 10-4 g/kg); C7, D7: the GNA group treated with GNA (0.73 g/kg); C8-C10, D8-D10: the YGP groups treated with YGP (3.6, 7.2, and 14.4 g/kg); C11-C13, D11-D13: the ZGP+YGP groups treated with ZGP + YGP (1.2 + 1.8, 2.4 + 3.6, and 4.8 + 7.2 g/kg). All the drug groups received daily oral gavage of their respective drugs dissolved with CMC-Na 0.5% solution at a specified dose for 8 weeks. ZGP: Zuogui pills; YGP: Yougui pills; ZGP+YGP: Zuogui pills + Yougui pills; EV: estradiol valerate; GNA: GengNianAn; 4-VCD: 4-vinyl cyclohexene diepoxide; PMS: Perimenopausal syndrome. Data are mean ± standard error of mean. Versus the control group (aP<0.001, dP<0.01) and versus the model group (bP<0.05, cP<0.01). A, B: n = 15 animals/group; C, D: n = 6 animals/group.
Figure 3 ZGP and YGP regulate multiple pathways and targets in PMS A: Venn diagram showing the shared common and unique targets of PMS and ZGP + YGP; B: Herb-target network of ZGP and YGP against PMS. KEGG enrichment analysis of potential pathways associated with (C) ZGP and (D) YGP. The bar charts are ranked by fold enrichment score. While in (C) and (D) top pathways and biological processes are ranked in descending order of -log (P-value) score. ZGP: Zuogui pills; YGP: Yougui pills; ZGP + YGP: Zuogui pills + Yougui pills; PMS: perimenopausal syndrome; KEGG: Kyoto Encyclopedia of Genes and Genomes.
Figure 4 ZGP and YGP restore deregulated apoptotic gene and protein levels in PMS A: RT-qPCR analysis of Bax, Bcl-2, and activated Caspase-3 expression levels in uterine tissues from 4-VCD-induced PMS mice treated with different drugs. A1: Bax mRNA expression; A2: Bcl-2 mRNA expression; A3: Caspase-3 mRNA expression levels. B: Western blotting analysis on the protein expression levels of Bax, Bcl-2, activated Caspase-3, and Bcl-2/Bax in ovary tissues from 4-VCD-induced PMS mice treated with different doses of the indicated drugs. 1: The control group; 2: the model group; 3: the ZGP group; 4: the YGP group; 5: the EV group; 6: the GNA group. B1: Bax protein expression; B2: Bcl-2 protein expression; B3: Caspase-3 protein expression; B4: Bcl-2/Bax protein expression levels. The control and model mice received daily oral gavage of CMC-Na 0.5% solution; the ZGP groups treated with ZGP (9.6 g/kg); the YGP groups treated with YGP (14.4 g/kg); the ZGP + YGP groups treated with ZGP + YGP (1.2 + 1.8 g/kg), the EV group treated with EV (1.3 × 10-4 g/kg) and the GNA group treated with GNA (0.73 g/kg). All the drug groups received daily oral gavage of their respective drugs dissolved with CMC-Na 0.5% solution at a specified dose for 8 weeks. RT-qPCR: real-time quantitative polymerase chain reaction; Bax: Bcl-2-associated X; Bcl-2: B-cell lymphoma-2; ZGP: Zuogui pills; YGP: Yougui pills; ZGP+YGP: Zuogui pills+Yougui pills; EV: estradiol valerate; GNA: GengNianAn; 4-VCD: 4-vinyl cyclohexene diepoxide; PMS: perimenopausal syndrome. Data are presented mean ± standard error of mean versus the control group, aP<0.001, fP<0.05; versus the model group, bP<0.01, cP<0.001, eP<0.05; ZGP + YGP group vs versus the ZGP group, dP<0.01, hP<0.05; ZGP + YGP vs YGP, gP<0.05, iP<0.01 from representative of three independent experiments. A, B: n = 3 animals/group.
| 1 |
Harlow SD, Gass M, Hall JE, et al. Executive summary of the stages of reproductive aging workshop + 10: addressing the unfinished agenda of staging reproductive aging. Climacteric 2012; 15: 105-14.
DOI URL |
| 2 | Miller VM, Kling JM, Files JA, et al. What's in a name: are menopausal “hot flashes” a symptom of menopause or a manifestation of neurovascular dysregulation? Menopause 2018; 25: 700-3. |
| 3 |
Talsania M, Scofield RH. Menopause and rheumatic disease. Rheum Dis Clin N Am 2017; 43: 287-302.
DOI |
| 4 |
Azam S, Lange T, Huynh S, et al. Hormone replacement therapy, mammographic density, and breast cancer risk: a cohort study. Cancer causes Control 2018; 29: 495-505.
DOI |
| 5 |
Zhang F, Cao JY, Zhang X, et al. Efficacy of self-made Gengnian decoction on phosphatidylinositol 3-kinases/protein kinase B/mammalian target of rapamycin signaling pathway in perimenopausal rats. J Tradit Chin Med 2019; 39: 861-6.
PMID |
| 6 |
Zhang K, Wang Z, Pan X, et al. Antidepressant-like effects of Xiaochaihutang in perimenopausal mice. J Ethnopharmacol 2020; 248: 112318.
DOI URL |
| 7 |
Xing X, Su L, Asare PF, et al. Danzhi Qing'e (DZQE) activates AMPK pathway and regulates lipid metabolism in a rat model of perimenopausal hyperlipidaemia. Exp Physiol 2016; 101: 1406-17.
DOI PMID |
| 8 | Wang Y, Yu W, Shi C, et al. Network Pharmacology of Yougui pill combined with Buzhong Yiqi decoction for the treatment of sexual dysfunction. Evid Based Complement Alternat Med 2019; 2019: 1243743. |
| 9 |
Li J, Sun K, Qi B, et al. An evaluation of the effects and safety of Zuogui pill for treating osteoporosis: current evidence for an ancient Chinese herbal formula. Phytother Res 2021; 35: 1754-67.
DOI PMID |
| 10 |
Li W, Liu Z, Liu L, et al. Effect of Zuogui pill and Yougui pill on osteoporosis: a randomized controlled trial. J Tradit Chin Med 2018; 38: 33-42.
PMID |
| 11 |
Peng H, Zeng L, Zhu L, et al. Zuogui Pills inhibit mitochondria-dependent apoptosis of follicles in a rat model of premature ovarian failure. J Ethnopharmacol 2019; 238: 111855.
DOI URL |
| 12 |
Fan Y, Chang Y, Wei L, et al. Apoptosis of mural granulosa cells is increased in women with diminished ovarian reserve. J Assist Reprod Genet 2019; 36: 1225-35.
DOI |
| 13 | Shi XL, Zhao C, Yang S, et al. Moxibustion reduces ovarian granulosa cell apoptosis associated with perimenopause in a natural aging rat model. Evid Based Complement Alternat Med. 2015; 2015: 742914. |
| 14 |
Smith BJ, Mattison DR, Sipes IG. The role of epoxidation in 4-vinylcyclohexene-induced ovarian toxicity. Toxicol Appl Pharmacol 1990; 105: 372-81.
DOI URL |
| 15 |
Boezio B, Audouze K, Ducrot P, et al. Network-based approaches in pharmacology. Mol Inform 2017; 36(10): 10.1002/minf.201700048.
DOI |
| 16 |
Li XY, Wang XY. Effect of Zuogui pill (Zuo Gui Wan) on monoamine neurotransmitters and sex hormones in climacteric rats with panic attack. Chin J Integr Med 2017; 23: 190-5.
DOI URL |
| 17 |
Cannady EA, Dyer CA, Christian PJ, et al. Expression and activity of cytochromes P450 2E1, 2A, and 2B in the mouse ovary: the effect of 4-vinylcyclohexene and its diepoxide metabolite. Toxicol Sci 2003; 73: 423-30.
PMID |
| 18 |
Kappeler CJ, Hoyer PB. 4-vinylcyclohexene diepoxide: a model chemical for ovotoxicity. Syst Biol Reprod Med 2012; 58: 57-62.
DOI PMID |
| 19 |
Rivera Z, Christian PJ, Marion SL, et al. Steroidogenic capacity of residual ovarian tissue in 4-vinylcyclohexene diepoxide-treated mice. Biol Reprod 2009; 80: 328-36.
DOI PMID |
| 20 | Muhammad FS, Goode AK, Kock ND, et al. Effects of 4-Vinylcyclohexene diepoxide on peripubertal and adult sprague-dawley rats: ovarian, clinical, and pathologic outcomes. Comp Med 2009; 59: 46-59. |
| 21 |
Peigné M, Decanter C. Serum AMH level as a marker of acute and long-term effects of chemotherapy on the ovarian follicular content: a systematic review. Reprod Biol Endocrinol 2014; 12: 26.
DOI URL |
| 22 |
Weenen C, Laven JS, Von Bergh AR, et al. Anti-Muèllerian hormone expression pattern in the human ovary: potential implications for initial and cyclic follicle recruitment. Mol Hum Reprod 2004; 10: 77-83.
DOI URL |
| 23 |
Guo Y, Zhao M, Bo T, et al. Blocking FSH inhibits hepatic cholesterol biosynthesis and reduces serum cholesterol. Cell Res 2019; 29: 151-66.
DOI PMID |
| 24 |
Zhou J, Qu F, Nan R, et al. The effect of Chinese medicinal herbs in relieving menopausal symptoms in ovariectomized Chinese women. Explore (NY) 2007; 3: 478-84.
DOI URL |
| Viewed | ||||||
|
Full text |
|
|||||
|
Abstract |
|
|||||
Sponsored by China Association of Chinese Medicine
& China Academy of Chinese Medical Sciences
16 Nanxiaojie, Dongzhimen Nei, Beijing, China. 100700 Email: jtcmen@126.com
Copyright 2020 Journal of Traditional Chinese Medicine. All rights reserved.
