Efficacy of glucocorticoids, chloroquine and vitamin A on cytokine release syndrome: a network pharmacology study

doi:10.19852/j.cnki.jtcm.2022.01.008

Abstract

Abstract:

OBJECTIVE: To verify the efficacy of glucocorticoids, chloroquine and vitamin A in the treatment of cytokine release syndrome (CRS), and to investigate the underlying mechanisms, based on network pharmacology.

METHODS: We used network pharmacology analysis and found 20 co-targeted genes of glucocorticoids, chloroquine, vitamin A and CRS. The pharmacological functions and therapeutic pathways of the genes were analyzed by gene ontology and Kyoto Encyclopedia of Genes and Genomes pathway enrichment. The candidate naturally bioactive compounds against the key genes were predicted by Traditional Chinese Medicine Systems Pharmacology Database and Analysis Platform. The anti-inflammatory activity of luteolin was assessed by real-time polymerase chain reaction.

RESULTS: Among the 20 co-targeted genes of glucocorticoids, chloroquine and vitamin A, interleukin 10 (IL-10), interleukin 2 (IL-2), interleukin 4 (IL-4) and tumor necrosis factor-α (TNF-α) were the key cytokines against CRS. The key pathway involved in the pharmacological mechanism could be cytokine-cytokine receptor interaction pathway, T cell receptor signaling pathway, Janus Kinase-signal transducer and activator of transcription signaling pathway and phosphatidylinositol 3-kinase-protein kinase B signaling pathway. Luteolin targeted by IL-10, IL-4, IL-2 and TNF-α could be one candidate drug for the treatment of CRS.

CONCLUSION: This study comprehensively elucidates the pharmacological mechanism for the treatment of CRS and provides a new method for the discovery of drugs for this disease.

Key words: glucocorticoids, chloroquine, vitamin A, cytokine release syndrome, inflammation, luteolin, network pharmacology

Jing ZHANG, Jingjing ZHU, Siqi HE, Jianxun WANG. Efficacy of glucocorticoids, chloroquine and vitamin A on cytokine release syndrome: a network pharmacology study[J]. Journal of Traditional Chinese Medicine, 2022, 42(1): 116-121.

Figures/Tables 5

Table 1 Real-time reverse transcription-polymerase chain reaction primers sequences

Gene	Mame	Primer (5'-3')
IL-2	Forward	ACAGGATGCAACTCCTGTCT
	Reverse	TGTGAGCATCCTGGTGAGTT
IL-4	Forward	CCAACTGCTTCCCCCTCTG
	Reverse	TCTGTTACGGTCAACTCGGTG
IL-10	Forward	GCCAAGCCTTGTCTGAGATG
	Reverse	GCATTCTTCACCTGCTCCAC
TNF-α	Forward	AGCACTGAAAGCATGATCCG
	Reverse	CCGATCACTCCAAAGTGCAG

Figure 1 An association network of anti-inflammation drugs of glucocorticoids, chloroquine and vitamin A targeted genes associated with CRS A: Venn diagram of CRS and anti-inflammation drugs of glucocorticoids, chloroquine and vitamin A targeted genes; B: PPI network of 20 co-targeted genes was analyzed and calculated by STRING; C: the interaction scores of the 20 co-targeted genes in the PPI network were ranked. CYP3A4: cytochrome P450 family 3 subfamily A member 4; ABCB1: ATP binding cassette subfamily B member 1; HSPA4: heat shock protein family A member 4; ALB: albumin; IGFBP3: insulin like growth factor binding protein 3; TLR4: toll like receptor 4; IL-18: interleukin 18; IFNA1: interferon alpha 1; TNFRSF1A: TNF receptor superfamily member 1A; IL-1RN: interleukin 1 receptor antagonist; IL-1R1: interleukin 1 receptor type 1; TNFRSF1B: TNF receptor superfamily member 1B; IL-2RA: interleukin 2 receptor subunit alpha; ITGAM: integrin subunit alpha M; CRS: cytokine release syndrome.

Figure 2 Gene ontology analysis and Kyoto Encyclopedia of Genes and Genomes pathway analysis A1-A3: the biological process, cell composition, and molecular function annotation of the 19 target genes; B: signal transduction pathway; C: non-infectious diseases associated pathway; D: infection associated pathway. The color scales indicate the different thresholds for the P-values, and the sizes of the dots represent the number of genes corresponding to each term.

Figure 3 Venn diagram of drugs targeting IL-10, IL-4, IL-2 and TNF-α A: common ingredients targeting; B: Traditional Chinese Medicine targeting IL-10, IL-4, IL-2 and TNF-α. IL: interleukin; TNF-α: tumor necrosis factor-α.

Figure 4 Regulation of expression of IL-10, IL-4, IL-2 and TNF-α in macrophages by Luteolin A: IL-2; B: IL-4; C: IL-10; D: TNF-α. Quantification of IL-10, IL-4, IL-2 and TNF-α mRNA was conducted by RT-PCR. The level of transcripts is normalized to β-actin mRNA. Error bars showed standard error of the mean, triplicate determinations. IL: interleukin; TNF-α: tumor necrosis factor-α. Statistical significance was calculated with analysis of variance with multiple comparisons, aP < 0.01, bP < 0.05.

References 33

[1]	Teijaro JR. Cytokine storms in infectious diseases. Semin Immunopathol 2017;39:501-3.
[2]	Perrin P, Collongues N, Baloglu S, et al. Cytokine release syndrome-associated encephalopathy in patients with COVID-19. Eur J Neurol 2021;28:248-58.
[3]	Chousterman BG, Swirski FK, Weber GF. Cytokine storm and sepsis disease pathogenesis. Semin Immunopathol 2017;39:517-28.
[4]	Tisoncik JR, Korth MJ, Simmons CP, et al. Into the eye of the cytokine storm. Microbiol Mol Biol Rev 2012;76:16-32.
[5]	Lau SKP, Lau CCY, Chan KH, et al. Delayed induction of proinflammatory cytokines and suppression of innate antiviral response by the novel Middle East respiratory syndrome coronavirus: implications for pathogenesis and treatment. J Gen Virol 2013;94:2679-90.
[6]	Channappanavar R, Perlman S. Pathogenic human coronavirus infections: causes and consequences of cytokine storm and immunopathology. Semin Immunopathol 2017;39:529-39.
[7]	Hirano T, Murakami M. COVID-19: a new virus, but a familiar receptor and cytokine release syndrome. Immunity 2020;52:731-3.
[8]	Giavridis T, van der Stegen SJC, Eyquem J, et al. CAR T cell-induced cytokine release syndrome is mediated by macrophages and abated by IL-1 blockade. Nature Medicine 2018;24:731-8.
[9]	Hay KA. Cytokine release syndrome and neurotoxicity after CD19 chimeric antigen receptor-modified: CAR-) T cell therapy. Br J Haematol 2018;183:364-74.
[10]	Yao X, Huang JQ, Zhong HH, et al. Targeting interleukin-6 in inflammatory autoimmune diseases and cancers. Pharmacol Ther 2014;141:125-39.
[11]	Rossi JF, Lu ZY, Jourdan M, et al. Interleukin-6 as a therapeutic target. Clinical Cancer Research 2015;21:1248-57.
[12]	Colson P, Rolain JM, Raoult D. Chloroquine for the 2019 novel coronavirus SARS-CoV-2. Int J Antimicrob Agents 2020;55:105923.
[13]	Vincent MJ, Bergeron E, Benjannet S, et al. Chloroquine is a potent inhibitor of SARS coronavirus infection and spread. Virol J 2005;2.
[14]	Li R, Wu K, Li Y, et al. Revealing the targets and mechanisms of vitamin A in the treatment of COVID-19. Aging-Us 2020;12:15784-96.
[15]	Vandewalle J, Luypaert A, De Bosscher K, et al. Therapeutic mechanisms of glucocorticoids. Trends Endocrinol Metab 2018;29:42-54.
[16]	Chen Y, Yuan T, Chen D, et al. Systematic analysis of molecular mechanism of resveratrol for treating pulmonary hypertension based on network pharmacology technology. Eur J Pharmacol 2020;888:173466.
[17]	Kong Q, Wu Y, Gu Y, et al. Analysis of the molecular mechanism of Pudilan: PDL) treatment for COVID-19 by network pharmacology tools. Biomed Pharmacother 2020;128:110316.
[18]	Stelzer G, Rosen N, Plaschkes I, et al. The GeneCards suite: from gene data mining to disease genome sequence analyses. Curr Protoc Bioinformatics 2016; 54 54: 1.30.1-1.30.33.
[19]	Bateman A, Martin M-J, Orchard S, et al. UniProt: the universal protein knowledgebase in 2021. Nucleic Acids Research 2021;49:D480-9.
[20]	Szklarczyk D, Gable AL, Lyon D, et al. STRING v11: protein-protein association networks with increased coverage, supporting functional discovery in genome-wide experimental datasets. Nucleic Acids Research 2019;47:D607-13.
[21]	Zhou YY, Zhou B, Pache L, et al. Metascape provides a biologist-oriented resource for the analysis of systems-level datasets. Nature Communications 2019;10:1523.
[22]	Ru JL, Li P, Wang JN, et al. TCMSP: a database of systems pharmacology for drug discovery from herbal medicines. J Cheminform 2014;6:13.
[23]	Ling CQ, Yue XQ, Ling C. Three advantages of using traditional Chinese medicine to prevent and treat tumor. J Integr Med 2014;12:331-5.
[24]	Brudno JN, Kochenderfer JN. Recent advances in CAR T-cell toxicity: mechanisms, manifestations and management. Blood Reviews 2019;34:45-55.
[25]	Caricchio R, Gallucci M, Dass C, et al. Preliminary predictive criteria for COVID-19 cytokine storm. Ann Rheum Dis 2021;80:88-95.
[26]	Qin YY, Zhou YH, Lu YQ, et al. Effectiveness of glucocorticoid therapy in patients with severe coronavirus disease 2019: protocol of a randomized controlled trial. Chin Med J: Engl) 2020;133:1080-6.
[27]	Pedersen SF, Ho YC. SARS-CoV-2: a storm is raging. J Clin Invest 2020;130:2202-5.
[28]	Han H, Ma QF, Li C, et al. Profiling serum cytokines in COVID-19 patients reveals IL-6 and IL-10 are disease severity predictors. Emerg Microbes Infect 2020;9:1123-30.
[29]	Riley JK, Takeda K, Akira S, et al. Interleukin-10 Receptor Signaling through the JAK-STAT Pathway. J Biol Chem 1999;274(23):16513-21.
[30]	Antoniv TT, Ivashkiv LB. Interleukin-10-induced gene expression and suppressive function are selectively modulated by the PI3K-Akt-GSK3 pathway. Immunology 2011;132:567-77.
[31]	Luo W, Li YX, Jiang LJ, et al. Targeting JAK-STAT Signaling to Control Cytokine Release Syndrome in COVID-19. Trends Pharmacol Sci 2020;41:531-43.
[32]	Nabavi SF, Braidy N, Gortzi O, et al. Luteolin as an anti-inflammatory and neuroprotective agent: a brief review. Brain Res Bull 2015;119:1-11.
[33]	A Xagorari AP, A Mauromatis, M Economou, et al. Luteolin inhibits an endotoxin-stimulated phosphorylation cascade and proinflammatory cytokine production in macrophages. J Pharmacol Exp Ther 2001;296:181-7.

Home

Online First

Author Center

Reviewer Center

Issues

Announcement

About Us