Effect of nourishing Yin and purging fire Chinese herbal mixture on delaying light-induced premature puberty in rats

doi:10.19852/j.cnki.jtcm.20230814.001

Abstract

Abstract:

OBJECTIVE: To elucidate the mechanism of the nourishing Yin and purging fire Chinese herbal mixture (NYPF) in delaying light-induced premature puberty in rats.

METHODS: Twenty-one days old female Sprague-Dawley rats were randomly assigned to normal group (N), long light exposure group (L), NYPF and normal saline group (NS). Rats in the L, NYPF and NS groups were exposed to 16 h: 350 lux light/8 h: dark, while rats in the N group were exposed to 12 h: 50 lux light/12 h: dark. NYPF and normal saline was administered to the rats in the NYPF group or NS group, respectively, from day 21. Five rats in every group were sacrificed at 9 p.m. on day 28 (P28), on the day when rat’s vulva opened in the L group (L-VO), on the day when the first estrous interphase occurred in rats of L group (L-E1), and on the day when the second estrous interphase occurred in rats of L group (L-E2), respectively.

RESULITS: On day 34, all rats in the L group, 80% of rats in the NS group, 40% of rats in the N group, and 20% of rats in the NYPF group showed complete opening of the vulva. At P28, mRNA level of hypothalamic kisspeptin (Kiss-1) in the L group was significantly higher than that in the N group (P < 0.05). The rats in the L and NS groups had significantly lower hypothalamic arginine-phenylalanine-amide (RFamide)-related peptide 3 (RFRP-3) mRNA levels than those in the N group (P < 0.05), whereas RFRP-3 mRNA level was significantly higher in the NYPF group than that in the L group (P < 0.05). At L-VO, the ovarian index of the L and NS groups was significantly higher than that of the N group (P < 0.05) and estradiol (E2) level of the NYPF group was significantly lower than that of the N and NS groups (P < 0.05); hypothalamic Kiss-1 mRNA level in the L and NS groups was significantly higher than that in the N and NYPF groups (P < 0.05), whereas hypothalamic RFRP-3 mRNA level in the L, NYPF, and NS groups was significantly lower than that in the N group (P < 0.05). At L-E1, E2 level of the L and NS groups was significantly higher than that of the N group (P < 0.01), whereas it was significantly lower in the NYPF group than that of the N, L, and NS groups (P < 0.01), and serum luteinizing hormone level of the L and NS groups was significantly higher than that of the N group (P < 0.05); levels of serum melatonin and ovarian melatonin receptor 1 (MT-1) mRNA in the L, NYPF, and NS groups were significantly lower than those in the N group (P < 0.05). At L-E2, the uterine organ index of the NYPF group was significantly lower than that of the L group (P < 0.05); and ovarian MT-1 mRNA level of the L and NS groups was significantly lower than that in the N group (P < 0.05).

CONCLUSIONS: NYPF can delay puberty onset in rats exposed to strong light for a prolonged duration, and regulation of the gene expression of Kiss-1 and RFRP-3 in the hypothalamus has been suggested as one of the mechanisms.

Key words: light, puberty, precocious, kisspeptins, RFRP-3, melatonin, Nourishing Yin and Purging Fire

SUN Yanyan, XUE Yuanyuan, SUN Wen, WANG Yonghong, YU Jian. Effect of nourishing Yin and purging fire Chinese herbal mixture on delaying light-induced premature puberty in rats[J]. Journal of Traditional Chinese Medicine, 2024, 44(1): 95-102.

Figures/Tables 6

References 31.

1.	Livadas S, Chrousos GP. Molecular and environmental mechanisms regulating puberty initiation: an integrated approach. Front Endocrinol (Lausanne) 2019; 10: 828. DOI URL
2.	Bohlen TM, Silveira MA, Buonfiglio D, et al. A short-day photoperiod delays the timing of puberty in female mice via changes in the kisspeptin system. Front Endocrinol (Lausanne) 2018; 9: 44. DOI URL
3.	Kauffman AS, Freeman DA, Zucker I. Termination of neuroendocrine refractoriness to melatonin in siberian hamsters (phodopus sungorus). J Neuroendocrinol 2003; 15: 191-6. PMID
4.	Yellon SM, Goldman BD. Photoperiod Control of reproductive development in the male djungarian hamster (phodopus sungorus). Endocrinology 1984; 114: 664-70. PMID
5.	Gorman MR. Temporal organization of pineal melatonin signaling in mammals. Mol Cell Endocrinol 2020; 503: 110687. DOI URL
6.	Chu EW, Wurtman RJ, Axelrod J. An inhibitory effect of melatonin on the estrous phase of the estrous cycle of the rodent. Endocrinology 1964; 75: 238-42. PMID
7.	Prata LM, Baracat EC, Simoes MJ. Effects of melatonin on the ovarian response to pinealectomy or continuous light in female rats: similarity with polycystic ovary syndrome. Braz J Med Biol Res 2004; 37: 987-95. PMID
8.	Revel FG, Saboureau M, Pevet P, Simonneaux V, Mikkelsen JD. RFamide-related peptide gene is a melatonin-driven photoperiodic gene. Endocrinology 2008; 149: 902-12. DOI PMID
9.	Cai DP, Chen BY, Zhang W, Li P. Effects of Chinese herbal medicine on modulating the course of puberty development in children with precocious puberty. Zhong Xi Yi Jie He Xue Bao 2006; 4: 166-74. DOI URL
10.	Cai DP, Ji ZY, Shi YM. Clinical study on treatment of female idiopathic precocious puberty with combined therapy of Chinese medicine and megestrol acetate. Zhong Guo Zhong Xi Yi Jie He Za Zhi 2001; 21: 732-5.
11.	Sun W, Han X, Wang Y, et al. Effectiveness of Ziyin Xiehuo granules and Zishen Qinggan granules on partial precocious puberty in girls: a multicenter, randomized, single-blind, controlled trial. J Tradit Chin Med 2018; 38: 740-5. PMID
12.	Xue YY, Lin YY, Sun W, Yu J, Wang YH. Effects of photoperiodic alternation on gonadal axis in male golden hamsters before puberty. Zhong Hua Zhong Yi Yao Za Zhi 2015; 30: 280-3.
13.	Sun Y, Perry GN, Yu J, Chen BY, Tian ZZ. Effect of nourishing "Yin"-removing "fire" Chinese herbal mixture on hypothalamic kisspeptin expression in female precocious rats. J Ethnopharmacol 2010; 127: 274-9. DOI PMID
14.	He YY, Han XH, Sun W, Yu J, Tamadon A. Precocious puberty and the lin28/let7 pathway: the therapeutic effect of the nourishing "Yin" and purging " fire" Traditional Chinese Medicine mixture in a rat model. Evid Based Complement Alternat Med 2018; 2018: 4868045.
15.	Zeng GL, Han XH, Yu J, Wang YH, Tian ZZ. Effect of nourishing "Yin" removing "fire" Chinese herbal mixture on hypothalamic mammalian target of rapamycin expression during onset of puberty in female rats. Evid Based Complement Alternat Med 2015; 2015: 157846.
16.	Waldhauser F, Boepple PA, Schemper M, Mansfield MJ, Crowley WJ. Serum melatonin in central precocious puberty is lower than in age-matched prepubertal children. J Clin Endocrinol Metab 1991; 73: 793-6. DOI URL
17.	Luboshitzky R, Lavi S, Thuma I, Herer P, Lavie P. Nocturnal secretory patterns of melatonin, luteinizing hormone, prolactin and cortisol in male patients with gonadotropin-releasing hormone deficiency. J Pineal Res 1996; 21: 49-54. PMID
18.	De Holanda FS, Tufik S, Bignotto M, et al. Evaluation of melatonin on the precocious puberty: a pilot study. Gynecol Endocrinol 2011; 27: 519-23. DOI PMID
19.	Klosen P, Lapmanee S, Schuster C, et al. MT1 and MT 2 melatonin receptors are expressed in nonoverlapping neuronal populations. J Pineal Res 2019; 67: e12575. DOI URL
20.	Waly NE, Hallworth R. Circadian pattern of melatonin MT1 and MT2 receptor localization in the rat suprachiasmatic nucleus. J Circadian Rhythms 2015; 13: 1. DOI PMID
21.	Tamura H, Kawamoto M, Sato S, et al. Long-term melatonin treatment delays ovarian aging. J Pineal Res 2017; 62: 10.
22.	Zhang L, Zhang Z, Wang J, et al. Melatonin regulates the activities of ovary and delays the fertility decline in female animals via MT1/AMPK pathway. J Pineal Res 2019; 66: e12550. DOI URL
23.	Barberino RS, Menezes VG, Ribeiro A, et al. Melatonin protects against cisplatin-induced ovarian damage in mice via the MT1 receptor and antioxidant activity. Biol Reprod 2017; 96: 1244-55. DOI PMID
24.	Ansel L, Bolborea M, Bentsen AH, et al. Differential regulation of kiss1 expression by melatonin and gonadal hormones in male and female syrian hamsters. J Biol Rhythms 2010; 25: 81-91. DOI URL
25.	Han XH, He YY, Zeng GL, et al. Intracerebroventricular injection of RFRP-3 delays puberty onset and stimulates growth hormone secretion in female rats. Reprod Biol Endocrinol 2017; 15: 35. DOI URL
26.	Sun W, Li SH, Tian ZZ, et al. Dynamic changes of RFRP3/GPR147 in the precocious puberty model female rats. Curr Mol Med 2019; 19: 766-75. DOI PMID
27.	Angelopoulou E, Quignon C, Kriegsfeld LJ, Simonneaux V. Functional implications of RFRP-3 in the central control of daily and seasonal rhythms in reproduction. Front Endocrinol (Lausanne) 2019; 10: 183. DOI URL
28.	Henningsen JB, Gauer F, Simonneaux V. RFRP neurons-the doorway to understanding seasonal reproduction in mammals. Front Endocrinol (Lausanne) 2016; 7: 36.
29.	Simonneaux V, Ancel C, Poirel VJ, Gauer F. Kisspeptins and RFRP-3 act in concert to synchronize rodent reproduction with seasons. Front Neurosci 2013; 7: 22.
30.	Singh P, Krishna A, Sridaran R, Tsutsui K. Immunohistochemical localization of GnRH and RFamide-related peptide-3 in the ovaries of mice during the estrous cycle. J Mol Histol 2011; 42: 371-81. DOI PMID
31.	Zhao S, Zhu E, Yang C, et al. RFamide-related peptide and messenger ribonucleic acid expression in mammalian testis: association with the spermatogenic cycle. Endocrinology 2010; 151: 617-27. DOI PMID

Gene name		Amplification fraction (bp)
GAPDH-F	ACTTTGGCATCGTGGAAGGG	128
GAPDH -R	TGCAGGGATGATGTTCTGGG	128
Kiss-1-F	GGTATGCAGAGAGCAAGCCT	122
Kiss-1-R	GATCAGGCGACTGCGGG	122
RFRP-3-F	ACTTCATGCTGGATGCTCGT	144
RFRP-3-R	ACATCACTACGATGAGCGCC	144
MT1-F	CGATTGCCCTGGTGGTTTTC	131
MT1-R	CGGCTTCAGTTTGGGTTTGC	131

Gene name		Amplification fraction (bp)
GAPDH-F	ACTTTGGCATCGTGGAAGGG	128
GAPDH -R	TGCAGGGATGATGTTCTGGG	128
Kiss-1-F	GGTATGCAGAGAGCAAGCCT	122
Kiss-1-R	GATCAGGCGACTGCGGG	122
RFRP-3-F	ACTTCATGCTGGATGCTCGT	144
RFRP-3-R	ACATCACTACGATGAGCGCC	144
MT1-F	CGATTGCCCTGGTGGTTTTC	131
MT1-R	CGGCTTCAGTTTGGGTTTGC	131

Group	n	Body weight (g)				Serum melatonin level (pg/mL)
Group	n	P28	L-VO	L-E1	L-E2	P28	L-VO	L-E1	L-E2
N	5	81.60±4.58	122.14±6.14	136.10±8.26	147.31±12.71	70.24±3.11	67.77±3.60	66.97±1.09	69.43±1.48
L	5	81.75±5.37	115.19±7.04	136.72±13.86	143.10±8.94	68.17±1.57	54.84±0.15	60.06±4.05^a	41.32±3.08
NYPF	5	80.10±1.61	111.70±10.21^a	124.48±6.59	146.69±13.02	65.06±4.24	63.74±5.24	60.41±2.45^a	41.59±4.08
NS	5	78.34±4.49	117.60±6.55	130.85±6.15	142.80±15.63	66.46±2.35	63.55±2.39	59.25±4.88^a	38.37±4.92

Group	n	Body weight (g)				Serum melatonin level (pg/mL)
Group	n	P28	L-VO	L-E1	L-E2	P28	L-VO	L-E1	L-E2
N	5	81.60±4.58	122.14±6.14	136.10±8.26	147.31±12.71	70.24±3.11	67.77±3.60	66.97±1.09	69.43±1.48
L	5	81.75±5.37	115.19±7.04	136.72±13.86	143.10±8.94	68.17±1.57	54.84±0.15	60.06±4.05^a	41.32±3.08
NYPF	5	80.10±1.61	111.70±10.21^a	124.48±6.59	146.69±13.02	65.06±4.24	63.74±5.24	60.41±2.45^a	41.59±4.08
NS	5	78.34±4.49	117.60±6.55	130.85±6.15	142.80±15.63	66.46±2.35	63.55±2.39	59.25±4.88^a	38.37±4.92

Group	n	Uterine organ index				Ovarian organ index
Group	n	P28	L-VO	L-E1	L-E2	P28	L-VO	L-E1	L-E2
N	5	0.52±0.10	1.40±0.15	1.17±0.31	1.37±0.12	0.41±0.04	0.43±0.06	0.51±0.07	0.50±0.07
L	5	0.53±0.05	1.55±0.70	1.13±0.30	1.54±0.26	0.40±0.03	0.55±0.03^b	0.41±0.03^b	0.46±0.06
NYPF	5	0.69±0.28	1.53±1.09	1.02±0.14	1.20±0.13^a	0.47±0.07	0.47±0.05	0.48±0.05	0.49±0.09
NS	5	0.76±0.30	1.45±0.63	1.12±0.10	1.41±0.18	0.43±0.05	0.58±0.08^b	0.45±0.09	0.52±0.08

Home

Online First

Author Center

Reviewer Center

Issues

Announcement

About Us