Journal of Traditional Chinese Medicine ›› 2024, Vol. 44 ›› Issue (1): 95-102.DOI: 10.19852/j.cnki.jtcm.20230814.001
• Original articles • Previous Articles Next Articles
SUN Yanyan1, XUE Yuanyuan2, SUN Wen1, WANG Yonghong1, YU Jian1(
)
Received:2022-08-03
Accepted:2022-11-15
Online:2024-02-15
Published:2023-08-14
Contact:
Dr. YU Jian, Department of Traditional Chinese Medicine, Children's Hospital of Fudan University, Shanghai 201102, China. yuj@shmu.edu.cn. Telephone: +86-21-64931219
Supported by:SUN Yanyan, XUE Yuanyuan, SUN Wen, WANG Yonghong, YU Jian. Effect of nourishing Yin and purging fire Chinese herbal mixture on delaying light-induced premature puberty in rats[J]. Journal of Traditional Chinese Medicine, 2024, 44(1): 95-102.
| Gene name | Primer sequence (5’ to 3’) | Amplification fraction (bp) | |
|---|---|---|---|
| GAPDH-F | ACTTTGGCATCGTGGAAGGG | 128 | |
| GAPDH -R | TGCAGGGATGATGTTCTGGG | ||
| Kiss-1-F | GGTATGCAGAGAGCAAGCCT | 122 | |
| Kiss-1-R | GATCAGGCGACTGCGGG | ||
| RFRP-3-F | ACTTCATGCTGGATGCTCGT | 144 | |
| RFRP-3-R | ACATCACTACGATGAGCGCC | ||
| MT1-F | CGATTGCCCTGGTGGTTTTC | 131 | |
| MT1-R | CGGCTTCAGTTTGGGTTTGC | ||
Table 1 Primer sequences
| Gene name | Primer sequence (5’ to 3’) | Amplification fraction (bp) | |
|---|---|---|---|
| GAPDH-F | ACTTTGGCATCGTGGAAGGG | 128 | |
| GAPDH -R | TGCAGGGATGATGTTCTGGG | ||
| Kiss-1-F | GGTATGCAGAGAGCAAGCCT | 122 | |
| Kiss-1-R | GATCAGGCGACTGCGGG | ||
| RFRP-3-F | ACTTCATGCTGGATGCTCGT | 144 | |
| RFRP-3-R | ACATCACTACGATGAGCGCC | ||
| MT1-F | CGATTGCCCTGGTGGTTTTC | 131 | |
| MT1-R | CGGCTTCAGTTTGGGTTTGC | ||
| Group | n | Body weight (g) | Serum melatonin level (pg/mL) | ||||||
|---|---|---|---|---|---|---|---|---|---|
| P28 | L-VO | L-E1 | L-E2 | P28 | L-VO | L-E1 | L-E2 | ||
| N | 5 | 81.60±4.58 | 122.14±6.14 | 136.10±8.26 | 147.31±12.71 | 70.24±3.11 | 67.77±3.60 | 66.97±1.09 | 69.43±1.48 |
| L | 5 | 81.75±5.37 | 115.19±7.04 | 136.72±13.86 | 143.10±8.94 | 68.17±1.57 | 54.84±0.15 | 60.06±4.05a | 41.32±3.08 |
| NYPF | 5 | 80.10±1.61 | 111.70±10.21a | 124.48±6.59 | 146.69±13.02 | 65.06±4.24 | 63.74±5.24 | 60.41±2.45a | 41.59±4.08 |
| NS | 5 | 78.34±4.49 | 117.60±6.55 | 130.85±6.15 | 142.80±15.63 | 66.46±2.35 | 63.55±2.39 | 59.25±4.88a | 38.37±4.92 |
Table 2 Comparison of body weight (g) and serum melatonin level (pg/mL) of rats at each time point ($\bar{x}±s$)
| Group | n | Body weight (g) | Serum melatonin level (pg/mL) | ||||||
|---|---|---|---|---|---|---|---|---|---|
| P28 | L-VO | L-E1 | L-E2 | P28 | L-VO | L-E1 | L-E2 | ||
| N | 5 | 81.60±4.58 | 122.14±6.14 | 136.10±8.26 | 147.31±12.71 | 70.24±3.11 | 67.77±3.60 | 66.97±1.09 | 69.43±1.48 |
| L | 5 | 81.75±5.37 | 115.19±7.04 | 136.72±13.86 | 143.10±8.94 | 68.17±1.57 | 54.84±0.15 | 60.06±4.05a | 41.32±3.08 |
| NYPF | 5 | 80.10±1.61 | 111.70±10.21a | 124.48±6.59 | 146.69±13.02 | 65.06±4.24 | 63.74±5.24 | 60.41±2.45a | 41.59±4.08 |
| NS | 5 | 78.34±4.49 | 117.60±6.55 | 130.85±6.15 | 142.80±15.63 | 66.46±2.35 | 63.55±2.39 | 59.25±4.88a | 38.37±4.92 |
| Group | n | Uterine organ index | Ovarian organ index | ||||||
|---|---|---|---|---|---|---|---|---|---|
| P28 | L-VO | L-E1 | L-E2 | P28 | L-VO | L-E1 | L-E2 | ||
| N | 5 | 0.52±0.10 | 1.40±0.15 | 1.17±0.31 | 1.37±0.12 | 0.41±0.04 | 0.43±0.06 | 0.51±0.07 | 0.50±0.07 |
| L | 5 | 0.53±0.05 | 1.55±0.70 | 1.13±0.30 | 1.54±0.26 | 0.40±0.03 | 0.55±0.03b | 0.41±0.03b | 0.46±0.06 |
| NYPF | 5 | 0.69±0.28 | 1.53±1.09 | 1.02±0.14 | 1.20±0.13a | 0.47±0.07 | 0.47±0.05 | 0.48±0.05 | 0.49±0.09 |
| NS | 5 | 0.76±0.30 | 1.45±0.63 | 1.12±0.10 | 1.41±0.18 | 0.43±0.05 | 0.58±0.08b | 0.45±0.09 | 0.52±0.08 |
Table 3 Comparison of organ index of uterus and ovary ($\bar{x}±s$)
| Group | n | Uterine organ index | Ovarian organ index | ||||||
|---|---|---|---|---|---|---|---|---|---|
| P28 | L-VO | L-E1 | L-E2 | P28 | L-VO | L-E1 | L-E2 | ||
| N | 5 | 0.52±0.10 | 1.40±0.15 | 1.17±0.31 | 1.37±0.12 | 0.41±0.04 | 0.43±0.06 | 0.51±0.07 | 0.50±0.07 |
| L | 5 | 0.53±0.05 | 1.55±0.70 | 1.13±0.30 | 1.54±0.26 | 0.40±0.03 | 0.55±0.03b | 0.41±0.03b | 0.46±0.06 |
| NYPF | 5 | 0.69±0.28 | 1.53±1.09 | 1.02±0.14 | 1.20±0.13a | 0.47±0.07 | 0.47±0.05 | 0.48±0.05 | 0.49±0.09 |
| NS | 5 | 0.76±0.30 | 1.45±0.63 | 1.12±0.10 | 1.41±0.18 | 0.43±0.05 | 0.58±0.08b | 0.45±0.09 | 0.52±0.08 |
| Group | n | E2 (pg/mL) | LH (mIU/mL) | FSH (mIU/mL) | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| P28 | L-VO | L-E1 | L-E2 | P28 | L-VO | L-E1 | L-E2 | P28 | L-VO | L-E1 | L-E2 | |||
| N | 5 | 6.05±0.85 | 14.51±1.11 | 16.45±0.36 | 27.16±1.45 | 9.47±0.69 | 10.38±0.29 | 9.69±0.16 | 10.51±0.57 | 7.90±0.29 | 9.02±0.34 | 9.01±0.18 | 8.95±0.39 | |
| L | 5 | 7.09±1.26 | 14.23±1.05 | 19.18±0.81a | 32.03±1.48 | 10.58±0.94 | 10.85±0.48 | 11.03±0.78a | 10.62±0.36 | 7.73±0.43 | 8.38±0.79 | 8.98±0.16 | 9.18±0.15 | |
| NYPF | 5 | 5.46±1.14 | 12.33±0.64a | 14.30±0.48ab | 27.63±1.10 | 10.54±0.17 | 10.01±0.64 | 10.34±0.55 | 10.53±0.48 | 7.59±0.29 | 8.93±0.13 | 8.99±0.42 | 9.15±0.82 | |
| NS | 5 | 6.72±1.66 | 14.77±1.26c | 18.22±0.28ac | 31.59±0.51 | 10.58±0.14 | 10.56±0.12 | 11.00±0.49a | 10.73±0.57 | 7.96±0.17 | 9.32±0.01 | 9.12±0.22 | 8.86±0.27 | |
Table 4 Comparison of serum sex hormone levels ($\bar{x}±s$)
| Group | n | E2 (pg/mL) | LH (mIU/mL) | FSH (mIU/mL) | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| P28 | L-VO | L-E1 | L-E2 | P28 | L-VO | L-E1 | L-E2 | P28 | L-VO | L-E1 | L-E2 | |||
| N | 5 | 6.05±0.85 | 14.51±1.11 | 16.45±0.36 | 27.16±1.45 | 9.47±0.69 | 10.38±0.29 | 9.69±0.16 | 10.51±0.57 | 7.90±0.29 | 9.02±0.34 | 9.01±0.18 | 8.95±0.39 | |
| L | 5 | 7.09±1.26 | 14.23±1.05 | 19.18±0.81a | 32.03±1.48 | 10.58±0.94 | 10.85±0.48 | 11.03±0.78a | 10.62±0.36 | 7.73±0.43 | 8.38±0.79 | 8.98±0.16 | 9.18±0.15 | |
| NYPF | 5 | 5.46±1.14 | 12.33±0.64a | 14.30±0.48ab | 27.63±1.10 | 10.54±0.17 | 10.01±0.64 | 10.34±0.55 | 10.53±0.48 | 7.59±0.29 | 8.93±0.13 | 8.99±0.42 | 9.15±0.82 | |
| NS | 5 | 6.72±1.66 | 14.77±1.26c | 18.22±0.28ac | 31.59±0.51 | 10.58±0.14 | 10.56±0.12 | 11.00±0.49a | 10.73±0.57 | 7.96±0.17 | 9.32±0.01 | 9.12±0.22 | 8.86±0.27 | |
| Group | n | Kiss-1 mRNA | RFRP-3 mRNA | ||||||
|---|---|---|---|---|---|---|---|---|---|
| P28 | L-VO | L-E1 | L-E2 | P28 | L-VO | L-E1 | L-E2 | ||
| N | 5 | 8.91±0.61 | 1.42±0.42 | 2.60±1.11 | 2.35±0.30 | 73.53±3.04 | 68.68±2.03 | 64.16±5.19 | 44.06±3.83 |
| L | 5 | 10.42±0.28a | 2.80±1.01a | 3.19±0.85 | 3.05±0.16 | 62.73±4.17a | 56.45±5.53a | 55.37±7.05 | 39.36±0.68 |
| NYPF | 5 | 10.11±1.03 | 1.54±0.41b | 2.69±0.04 | 2.89±0.11 | 70.37±3.04b | 60.19±3.62a | 57.99±3.43 | 46.68±7.08 |
| NS | 5 | 9.97±0.35 | 2.99±0.24ac | 2.01±0.21 | 3.16±0.82 | 67.37±2.39a | 61.74±1.59a | 52.15±1.79a | 40.76±9.70 |
Table 5 Kiss-1 and RFRP-3 mRNA levels in hypothalamus ($\bar{x}±s$)
| Group | n | Kiss-1 mRNA | RFRP-3 mRNA | ||||||
|---|---|---|---|---|---|---|---|---|---|
| P28 | L-VO | L-E1 | L-E2 | P28 | L-VO | L-E1 | L-E2 | ||
| N | 5 | 8.91±0.61 | 1.42±0.42 | 2.60±1.11 | 2.35±0.30 | 73.53±3.04 | 68.68±2.03 | 64.16±5.19 | 44.06±3.83 |
| L | 5 | 10.42±0.28a | 2.80±1.01a | 3.19±0.85 | 3.05±0.16 | 62.73±4.17a | 56.45±5.53a | 55.37±7.05 | 39.36±0.68 |
| NYPF | 5 | 10.11±1.03 | 1.54±0.41b | 2.69±0.04 | 2.89±0.11 | 70.37±3.04b | 60.19±3.62a | 57.99±3.43 | 46.68±7.08 |
| NS | 5 | 9.97±0.35 | 2.99±0.24ac | 2.01±0.21 | 3.16±0.82 | 67.37±2.39a | 61.74±1.59a | 52.15±1.79a | 40.76±9.70 |
| Group | n | Hypothalamus | Pituitary | Ovary | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| P28 | L-VO | L-E1 | L-E2 | P28 | L-VO | L-E1 | L-E2 | P28 | L-VO | L-E1 | L-E2 | ||
| N | 5 | 0.371±0.090 | 0.373±0.128 | 0.122±0.021 | 0.633±0.118 | 4.272±0.401 | 2.722±1.021 | 3.543±0.079 | 3.760±0.971 | 2.412±0.499 | 0.281±0.030 | 0.531±0.072 | 0.809±0.471 |
| L | 5 | 0.412±0.111 | 0.331±0.014 | 0.561±0.661 | 0.483±0.172 | 4.531±0.183 | 2.992±1.007 | 3.581±0.769 | 2.571±0.892 | 2.361±0.308 | 0.312±0.089 | 0.320±0.081 a | 0.241±0.081 a |
| NYPF | 5 | 0.317±0.061 | 0.320±0.072 | 0.345±0.191 | 0.441±0.162 | 4.812±0.147 | 2.7911±0.703 | 3.811±0.691 | 2.978±1.518 | 2.242±0.201 | 0.433±0.139 | 0.331±0.049 a | 0.729±0.241 |
| NS | 5 | 0.247±0.072 | 0.413±0.091 | 0.634±0.321 | 0.462±0.049 | 4.992±0.609 | 3.042±0.898 | 3.991±0.542 | 3.221±0.891 | 2.231±0.092 | 0.311±0.022 | 0.341±0.019a | 0.279±0.082 a |
Table 6 MT 1 mRNA levels in hypothalamus, pituitary and ovary ($\bar{x}±s$)
| Group | n | Hypothalamus | Pituitary | Ovary | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| P28 | L-VO | L-E1 | L-E2 | P28 | L-VO | L-E1 | L-E2 | P28 | L-VO | L-E1 | L-E2 | ||
| N | 5 | 0.371±0.090 | 0.373±0.128 | 0.122±0.021 | 0.633±0.118 | 4.272±0.401 | 2.722±1.021 | 3.543±0.079 | 3.760±0.971 | 2.412±0.499 | 0.281±0.030 | 0.531±0.072 | 0.809±0.471 |
| L | 5 | 0.412±0.111 | 0.331±0.014 | 0.561±0.661 | 0.483±0.172 | 4.531±0.183 | 2.992±1.007 | 3.581±0.769 | 2.571±0.892 | 2.361±0.308 | 0.312±0.089 | 0.320±0.081 a | 0.241±0.081 a |
| NYPF | 5 | 0.317±0.061 | 0.320±0.072 | 0.345±0.191 | 0.441±0.162 | 4.812±0.147 | 2.7911±0.703 | 3.811±0.691 | 2.978±1.518 | 2.242±0.201 | 0.433±0.139 | 0.331±0.049 a | 0.729±0.241 |
| NS | 5 | 0.247±0.072 | 0.413±0.091 | 0.634±0.321 | 0.462±0.049 | 4.992±0.609 | 3.042±0.898 | 3.991±0.542 | 3.221±0.891 | 2.231±0.092 | 0.311±0.022 | 0.341±0.019a | 0.279±0.082 a |
| 1. |
Livadas S, Chrousos GP. Molecular and environmental mechanisms regulating puberty initiation: an integrated approach. Front Endocrinol (Lausanne) 2019; 10: 828.
DOI URL |
| 2. |
Bohlen TM, Silveira MA, Buonfiglio D, et al. A short-day photoperiod delays the timing of puberty in female mice via changes in the kisspeptin system. Front Endocrinol (Lausanne) 2018; 9: 44.
DOI URL |
| 3. |
Kauffman AS, Freeman DA, Zucker I. Termination of neuroendocrine refractoriness to melatonin in siberian hamsters (phodopus sungorus). J Neuroendocrinol 2003; 15: 191-6.
PMID |
| 4. |
Yellon SM, Goldman BD. Photoperiod Control of reproductive development in the male djungarian hamster (phodopus sungorus). Endocrinology 1984; 114: 664-70.
PMID |
| 5. |
Gorman MR. Temporal organization of pineal melatonin signaling in mammals. Mol Cell Endocrinol 2020; 503: 110687.
DOI URL |
| 6. |
Chu EW, Wurtman RJ, Axelrod J. An inhibitory effect of melatonin on the estrous phase of the estrous cycle of the rodent. Endocrinology 1964; 75: 238-42.
PMID |
| 7. |
Prata LM, Baracat EC, Simoes MJ. Effects of melatonin on the ovarian response to pinealectomy or continuous light in female rats: similarity with polycystic ovary syndrome. Braz J Med Biol Res 2004; 37: 987-95.
PMID |
| 8. |
Revel FG, Saboureau M, Pevet P, Simonneaux V, Mikkelsen JD. RFamide-related peptide gene is a melatonin-driven photoperiodic gene. Endocrinology 2008; 149: 902-12.
DOI PMID |
| 9. |
Cai DP, Chen BY, Zhang W, Li P. Effects of Chinese herbal medicine on modulating the course of puberty development in children with precocious puberty. Zhong Xi Yi Jie He Xue Bao 2006; 4: 166-74.
DOI URL |
| 10. | Cai DP, Ji ZY, Shi YM. Clinical study on treatment of female idiopathic precocious puberty with combined therapy of Chinese medicine and megestrol acetate. Zhong Guo Zhong Xi Yi Jie He Za Zhi 2001; 21: 732-5. |
| 11. |
Sun W, Han X, Wang Y, et al. Effectiveness of Ziyin Xiehuo granules and Zishen Qinggan granules on partial precocious puberty in girls: a multicenter, randomized, single-blind, controlled trial. J Tradit Chin Med 2018; 38: 740-5.
PMID |
| 12. | Xue YY, Lin YY, Sun W, Yu J, Wang YH. Effects of photoperiodic alternation on gonadal axis in male golden hamsters before puberty. Zhong Hua Zhong Yi Yao Za Zhi 2015; 30: 280-3. |
| 13. |
Sun Y, Perry GN, Yu J, Chen BY, Tian ZZ. Effect of nourishing "Yin"-removing "fire" Chinese herbal mixture on hypothalamic kisspeptin expression in female precocious rats. J Ethnopharmacol 2010; 127: 274-9.
DOI PMID |
| 14. | He YY, Han XH, Sun W, Yu J, Tamadon A. Precocious puberty and the lin28/let7 pathway: the therapeutic effect of the nourishing "Yin" and purging " fire" Traditional Chinese Medicine mixture in a rat model. Evid Based Complement Alternat Med 2018; 2018: 4868045. |
| 15. | Zeng GL, Han XH, Yu J, Wang YH, Tian ZZ. Effect of nourishing "Yin" removing "fire" Chinese herbal mixture on hypothalamic mammalian target of rapamycin expression during onset of puberty in female rats. Evid Based Complement Alternat Med 2015; 2015: 157846. |
| 16. |
Waldhauser F, Boepple PA, Schemper M, Mansfield MJ, Crowley WJ. Serum melatonin in central precocious puberty is lower than in age-matched prepubertal children. J Clin Endocrinol Metab 1991; 73: 793-6.
DOI URL |
| 17. |
Luboshitzky R, Lavi S, Thuma I, Herer P, Lavie P. Nocturnal secretory patterns of melatonin, luteinizing hormone, prolactin and cortisol in male patients with gonadotropin-releasing hormone deficiency. J Pineal Res 1996; 21: 49-54.
PMID |
| 18. |
De Holanda FS, Tufik S, Bignotto M, et al. Evaluation of melatonin on the precocious puberty: a pilot study. Gynecol Endocrinol 2011; 27: 519-23.
DOI PMID |
| 19. |
Klosen P, Lapmanee S, Schuster C, et al. MT1 and MT 2 melatonin receptors are expressed in nonoverlapping neuronal populations. J Pineal Res 2019; 67: e12575.
DOI URL |
| 20. |
Waly NE, Hallworth R. Circadian pattern of melatonin MT1 and MT2 receptor localization in the rat suprachiasmatic nucleus. J Circadian Rhythms 2015; 13: 1.
DOI PMID |
| 21. | Tamura H, Kawamoto M, Sato S, et al. Long-term melatonin treatment delays ovarian aging. J Pineal Res 2017; 62: 10. |
| 22. |
Zhang L, Zhang Z, Wang J, et al. Melatonin regulates the activities of ovary and delays the fertility decline in female animals via MT1/AMPK pathway. J Pineal Res 2019; 66: e12550.
DOI URL |
| 23. |
Barberino RS, Menezes VG, Ribeiro A, et al. Melatonin protects against cisplatin-induced ovarian damage in mice via the MT1 receptor and antioxidant activity. Biol Reprod 2017; 96: 1244-55.
DOI PMID |
| 24. |
Ansel L, Bolborea M, Bentsen AH, et al. Differential regulation of kiss1 expression by melatonin and gonadal hormones in male and female syrian hamsters. J Biol Rhythms 2010; 25: 81-91.
DOI URL |
| 25. |
Han XH, He YY, Zeng GL, et al. Intracerebroventricular injection of RFRP-3 delays puberty onset and stimulates growth hormone secretion in female rats. Reprod Biol Endocrinol 2017; 15: 35.
DOI URL |
| 26. |
Sun W, Li SH, Tian ZZ, et al. Dynamic changes of RFRP3/GPR147 in the precocious puberty model female rats. Curr Mol Med 2019; 19: 766-75.
DOI PMID |
| 27. |
Angelopoulou E, Quignon C, Kriegsfeld LJ, Simonneaux V. Functional implications of RFRP-3 in the central control of daily and seasonal rhythms in reproduction. Front Endocrinol (Lausanne) 2019; 10: 183.
DOI URL |
| 28. | Henningsen JB, Gauer F, Simonneaux V. RFRP neurons-the doorway to understanding seasonal reproduction in mammals. Front Endocrinol (Lausanne) 2016; 7: 36. |
| 29. | Simonneaux V, Ancel C, Poirel VJ, Gauer F. Kisspeptins and RFRP-3 act in concert to synchronize rodent reproduction with seasons. Front Neurosci 2013; 7: 22. |
| 30. |
Singh P, Krishna A, Sridaran R, Tsutsui K. Immunohistochemical localization of GnRH and RFamide-related peptide-3 in the ovaries of mice during the estrous cycle. J Mol Histol 2011; 42: 371-81.
DOI PMID |
| 31. |
Zhao S, Zhu E, Yang C, et al. RFamide-related peptide and messenger ribonucleic acid expression in mammalian testis: association with the spermatogenic cycle. Endocrinology 2010; 151: 617-27.
DOI PMID |
| [1] | Deng Zhihao, Yan Yan, Zhao Baoming, Wang Rui, Wang Xiaofeng, Chen Haoxuan, Wen Binyu. Identification of the active ingredients from Guangtongxiao decoction in rat bile based on ultra-performance liquid chromatography/Synapt G2 quadrupole time-of-flight tandem mass spectrometry [J]. Journal of Traditional Chinese Medicine, 2020, 40(6): 999-1006. |
| [2] | Zhou Peijuan, Wang Aicheng, Li Bai, Liu Chunyan, Wang Yu. Effect of acupuncture at Fengchi(GB 20)on the activity of myosin light chain kinase in the middle meningeal artery of migraine modeled rats [J]. Journal of Traditional Chinese Medicine, 2015, 35(03): 301-305. |
| Viewed | ||||||
|
Full text |
|
|||||
|
Abstract |
|
|||||
Sponsored by China Association of Chinese Medicine
& China Academy of Chinese Medical Sciences
16 Nanxiaojie, Dongzhimen Nei, Beijing, China. 100700 Email: jtcmen@126.com
Copyright 2020 Journal of Traditional Chinese Medicine. All rights reserved.
