Journal of Traditional Chinese Medicine ›› 2022, Vol. 42 ›› Issue (4): 546-555.DOI: 10.19852/j.cnki.jtcm.20220516.003
• Research Articles • Previous Articles Next Articles
FU Yang, YUAN Peipei, ZENG Mengnan, HOU Ying, GAO Liyuan, WEI Yaxin, ZHENG Xiaoke(), FENG Weisheng
Received:
2022-01-12
Accepted:
2022-04-19
Online:
2022-08-15
Published:
2022-07-12
Contact:
ZHENG Xiaoke
About author:
Prof. ZHENG Xiaoke, Department of Pharmacy, Henan University of Chinese Medicine, Zhengzhou 450046, China. zhengxk.2006@163.com, Telephone: +86-371-60190296Supported by:
FU Yang, YUAN Peipei, ZENG Mengnan, HOU Ying, GAO Liyuan, WEI Yaxin, ZHENG Xiaoke, FENG Weisheng. Studying the nature of ascending-descending-floating-sinking of Chinese medicines based on gonadotropin-releasing hormone[J]. Journal of Traditional Chinese Medicine, 2022, 42(4): 546-555.
Target | Forward Primer (5’-3’) | Reverse Primer (5’-3’) |
---|---|---|
GnRhR | GGCATTTGCCACCTCCTTTG | ATAAGTGGGTCGAAGCACGG |
AR | ATCAAGCTGGAGAACCCGTC | CTAGCCAAGTCCCCATAGCG |
SCP3 | CGGAGCAGCTGAACAAACATC | TGGTGGTTTCCCAGATTTCCC |
SYCP2 | TGATGCAAGTGGATCACAGATTC | CTGCTGCTGTTGTCTGGTTC |
REC8 | ACGTGGTAAAGACCTGCGAG | AAGCTGGGCGGAGAGATAGA |
SYCE1 | GGGGTACAGATCCTTGCTCA | CGCTCTTGGACTGTCTCCTT |
SMC1B | GTAGATGCAGCCCTGGACAA | GGGTAGACGCCTATCAGTGC |
SMC3 | GCACTTGCCGCTAAGAGAGA | TCCGCCGGAAATGGTCTAAC |
GAPDH | ACAGCAACAGGGTGGTGGAC | TTTGAGGGTGCAGCGAACTT |
Table 1 Primer sequences
Target | Forward Primer (5’-3’) | Reverse Primer (5’-3’) |
---|---|---|
GnRhR | GGCATTTGCCACCTCCTTTG | ATAAGTGGGTCGAAGCACGG |
AR | ATCAAGCTGGAGAACCCGTC | CTAGCCAAGTCCCCATAGCG |
SCP3 | CGGAGCAGCTGAACAAACATC | TGGTGGTTTCCCAGATTTCCC |
SYCP2 | TGATGCAAGTGGATCACAGATTC | CTGCTGCTGTTGTCTGGTTC |
REC8 | ACGTGGTAAAGACCTGCGAG | AAGCTGGGCGGAGAGATAGA |
SYCE1 | GGGGTACAGATCCTTGCTCA | CGCTCTTGGACTGTCTCCTT |
SMC1B | GTAGATGCAGCCCTGGACAA | GGGTAGACGCCTATCAGTGC |
SMC3 | GCACTTGCCGCTAAGAGAGA | TCCGCCGGAAATGGTCTAAC |
GAPDH | ACAGCAACAGGGTGGTGGAC | TTTGAGGGTGCAGCGAACTT |
Chinese medicine | Main chemical |
---|---|
Mahuang (Herba Ephedra Sinica) | Ephedrine, Pseudoephedrine |
Chaihu (Radix Bupleuri Chinensis) | Saikosaponin a, Saikosaponind |
Shengma (Rhizoma Cimicifugae Foetidae) | Cimigenol, Cimicifugoside, 25-Omethylcimicgenol, Dahurinol, Dehydroxydahurinol |
Gegen (Radix Puerariae Lobatae) | Puerarin, 3-hydroxy Puerarin, Kudzusapogenol C&A |
Bohe (Herba Menthae Haplocalycis) | L-Menthol, Menthone, L-Menthone, Menthyl acetate N-decyl Acetate |
Jiegeng (Radix Platycodi) | Platycodigenin, PlatycodinD |
Dingxiang (Flos Syzygii Aromatici) | Eugenol, Isoeugenol, Eugenyl acetate |
Kuxingren (Semen Armeniacae Amarum) | Amygdalin |
Chuanniuxi (Radix Cyathulae) | Cyasterone |
Fuling (Poria) | Dehydrotumulosic acid, Polyporenic acid C, DehydropachyMic acid, Pachymic acid |
Daodou (Canavaliae Semen) | Gallic acid, β-sitosterol, Lupeol |
Xuanfuhua (Flos Inulae Japonicae) | Inulicin, Inunolide, Chlorogenic acid |
Tinglizi (Semen Lepidii Apetali) | Quercetin 3-O-β-D-glucose-7-O-β-D-gentiobioside, Sinapin tyiocyante |
Chuanxiong (Rhizoma Chuanxiong) | Ligustilide, Senkyunolide A, Senkyunolide I |
Table 2 Main chemicals in typical floating and sinking Chinese medicines
Chinese medicine | Main chemical |
---|---|
Mahuang (Herba Ephedra Sinica) | Ephedrine, Pseudoephedrine |
Chaihu (Radix Bupleuri Chinensis) | Saikosaponin a, Saikosaponind |
Shengma (Rhizoma Cimicifugae Foetidae) | Cimigenol, Cimicifugoside, 25-Omethylcimicgenol, Dahurinol, Dehydroxydahurinol |
Gegen (Radix Puerariae Lobatae) | Puerarin, 3-hydroxy Puerarin, Kudzusapogenol C&A |
Bohe (Herba Menthae Haplocalycis) | L-Menthol, Menthone, L-Menthone, Menthyl acetate N-decyl Acetate |
Jiegeng (Radix Platycodi) | Platycodigenin, PlatycodinD |
Dingxiang (Flos Syzygii Aromatici) | Eugenol, Isoeugenol, Eugenyl acetate |
Kuxingren (Semen Armeniacae Amarum) | Amygdalin |
Chuanniuxi (Radix Cyathulae) | Cyasterone |
Fuling (Poria) | Dehydrotumulosic acid, Polyporenic acid C, DehydropachyMic acid, Pachymic acid |
Daodou (Canavaliae Semen) | Gallic acid, β-sitosterol, Lupeol |
Xuanfuhua (Flos Inulae Japonicae) | Inulicin, Inunolide, Chlorogenic acid |
Tinglizi (Semen Lepidii Apetali) | Quercetin 3-O-β-D-glucose-7-O-β-D-gentiobioside, Sinapin tyiocyante |
Chuanxiong (Rhizoma Chuanxiong) | Ligustilide, Senkyunolide A, Senkyunolide I |
Figure 1 Effects of typical floating and sinking Chinese treatments on testicular coefficient and sex hormone levels in normal male rats A: testis index of each group of rats; B-D: levels of GnRH, LH, and testosterone (T) of each group of rats. NC: Normal control group; MH: Mahuang (Herba Ephedra Sinica); CH: Chaihu (Radix Bupleuri Chinensis); SM: Shengma (Rhizoma Cimicifugae Foetidae); GG: Gegen (Radix Puerariae Lobatae); BH: Bohe (Herba Menthae Haplocalycis); JG: Jiegeng (Radix Platycodi); DX: Dingxiang (Flos Syzygii Aromatici); KXR: Kuxingren (Semen Armeniacae Amarum); CNX: Chuanniuxi (Radix Cyathulae); FL: Fuling (Poria); DD: Daodou (Canavaliae Semen); XFH: Xuanfuhua (Flos Inulae Japonicae); TLZ: Tinglizi (Semen Lepidii Apetali); CX: Chuanxiong (Rhizoma Chuanxiong). GnRh: gonadotropin-releasing hormone; LH: luteinising hormone; T: testosterone. MH (4.2 g/kg), CH (7 g/kg), SM (7 g/kg), GG (10.5 g/kg), BH (4.2 g/kg), JG (7 g/kg), DX (2.1 g/kg), KXR (7 g/kg), CNX (7 g/kg), FL (10.5 g/kg), DD (6.3 g/kg), XFH (6.3 g/kg), TLZ (7 g/kg), and CX (7 g/kg) were administered to the rats of different groups by oral gavage. The data represent the mean ± standard deviation of eight rats in each group. Compared with the normal group, aP < 0.01, bP < 0.05.
Figure 2 Effect of typical floating and sinking Chinese medicines on GnRhR expression in the testis of normal male rats A: effect of typical floating Chinese medicines on GnRhR expression in the testis of normal male rats; B: effect of typical sinking Chinese medicines on GnRhR expression in the testis of normal male rats.NC: Normal control group; MH: Mahuang (Herba Ephedra Sinica); CH: Chaihu (Radix Bupleuri Chinensis); SM: Shengma (Rhizoma Cimicifugae Foetidae); GG: Gegen (Radix Puerariae Lobatae); BH: Bohe (Herba Menthae Haplocalycis); JG: Jiegeng (Radix Platycodi); DX: Dingxiang (Flos Syzygii Aromatici); KXR: Kuxingren (Semen Armeniacae Amarum); CNX: Chuanniuxi (Radix Cyathulae); FL: Fuling (Poria); DD: Daodou (Canavaliae Semen); XFH: Xuanfuhua (Flos Inulae Japonicae); TLZ: Tinglizi (Semen Lepidii Apetali); CX: Chuanxiong (Rhizoma Chuanxiong). MH (4.2 g/kg), CH (7 g/kg), SM (7 g/kg), GG (10.5 g/kg), BH (4.2 g/kg), JG (7 g/kg), DX (2.1 g/kg), KXR (7 g/kg), CNX (7 g/kg), FL (10.5 g/kg), DD (6.3 g/kg), XFH (6.3 g/kg), TLZ (7 g/kg), and CX (7 g/kg) were administered to the rats of different groups by oral gavage. GnRhR: gonadotropin-releasing hormone receptor. The data represent the mean ± standard deviation of eight rats in each group. The data represent the mean ± standard deviation of eight rats in each group. Compared with the normal group, aP < 0.05, bP < 0.01.
Group | n | GnRhR | AR | SCP3 | SYCE1 | SMC1B | SMC3 | SYCP2 | REC8 |
---|---|---|---|---|---|---|---|---|---|
MH | 8 | 2.44±0.67a | 1.75±0.33b | 1.29±0.10a | 1.31±0.18b | 1.40±0.06a | 1.46±0.24b | 2.78±0.37a | 1.64±0.22a |
CH | 8 | 2.63±0.47a | 1.72±0.45b | 1.24±0.16a | 1.31±0.13b | 1.38±0.23b | 1.43±0.21b | 1.66±0.33 | 1.44±0.02b |
SM | 8 | 2.00±0.19a | 2.10±0.68a | 1.42±0.03a | 1.36±0.10b | 1.40±0.08a | 2.04±0.10a | 1.99±0.75b | 1.41±0.03b |
GG | 8 | 1.50±0.14b | 2.04±0.64a | 1.33±0.06a | 1.35±0.08b | 1.57±0.29a | 1.41±0.14b | 2.80±0.67a | 1.83±0.15a |
BH | 8 | 1.44±0.03 | 1.66±0.65 | 1.19±0.19 | 1.26±0.25 | 1.27±0.08 | 1.14±0.08 | 1.18±0.26 | 1.28±0.12 |
JG | 8 | 1.69±0.35a | 1.95±0.75a | 1.4±0.03a | 1.28±0.14b | 1.65±0.25a | 1.84±0.12a | 2.77±1.04a | 2.13±0.19a |
NC | 8 | 1.00±0.32 | 1.00±0.17 | 1.00±0.22 | 1.00±0.02 | 1.00±0.03 | 1.00±0.26 | 1.00±0.44 | 1.00±0.24 |
Table 3 Effects of typical floating Chinese medicines on sperm meiosis-related mRNA levels in the testis of normal male rats ($\bar{x}±s$)
Group | n | GnRhR | AR | SCP3 | SYCE1 | SMC1B | SMC3 | SYCP2 | REC8 |
---|---|---|---|---|---|---|---|---|---|
MH | 8 | 2.44±0.67a | 1.75±0.33b | 1.29±0.10a | 1.31±0.18b | 1.40±0.06a | 1.46±0.24b | 2.78±0.37a | 1.64±0.22a |
CH | 8 | 2.63±0.47a | 1.72±0.45b | 1.24±0.16a | 1.31±0.13b | 1.38±0.23b | 1.43±0.21b | 1.66±0.33 | 1.44±0.02b |
SM | 8 | 2.00±0.19a | 2.10±0.68a | 1.42±0.03a | 1.36±0.10b | 1.40±0.08a | 2.04±0.10a | 1.99±0.75b | 1.41±0.03b |
GG | 8 | 1.50±0.14b | 2.04±0.64a | 1.33±0.06a | 1.35±0.08b | 1.57±0.29a | 1.41±0.14b | 2.80±0.67a | 1.83±0.15a |
BH | 8 | 1.44±0.03 | 1.66±0.65 | 1.19±0.19 | 1.26±0.25 | 1.27±0.08 | 1.14±0.08 | 1.18±0.26 | 1.28±0.12 |
JG | 8 | 1.69±0.35a | 1.95±0.75a | 1.4±0.03a | 1.28±0.14b | 1.65±0.25a | 1.84±0.12a | 2.77±1.04a | 2.13±0.19a |
NC | 8 | 1.00±0.32 | 1.00±0.17 | 1.00±0.22 | 1.00±0.02 | 1.00±0.03 | 1.00±0.26 | 1.00±0.44 | 1.00±0.24 |
Group | n | GnRhR | AR | SCP3 | SYCE1 | SMC1B | SMC3 | SYCP2 | REC8 |
---|---|---|---|---|---|---|---|---|---|
DX | 8 | 0.82±0.3 | 0.57±0.01 | 0.59±0.16b | 0.51±0.02b | 0.64±0.05b | 0.90±0.23 | 0.96±0.46 | 0.39±0.17b |
KXR | 8 | 0.44±0.16a | 0.58±0.03 | 0.59±0.16b | 0.63±0.11b | 0.89±0.14 | 1.36±0.16 | 0.66±0.19 | 0.37±0.10b |
CNX | 8 | 0.75±0.34 | 1.46±0.77 | 0.60±0.02b | 0.50±0.06b | 0.78±0.14b | 1.02±0.17 | 0.69±0.13 | 0.69±0.04a |
FL | 8 | 0.88±0.04 | 1.01±0.43 | 0.59±0.09b | 0.49±0.08b | 0.64±0.04b | 1.09±0.22 | 0.96±0.38 | 0.58±0.25a |
DD | 8 | 0.75±0.01 | 0.99±0.36 | 0.62±0.08b | 0.44±0.03b | 0.60±0.12b | 0.83±0.07 | 1.33±0.25 | 0.57±0.01a |
XFH | 8 | 0.50±0.12a | 1.17±0.51 | 0.57±0.05b | 0.57±0.05b | 0.67±0.02b | 1.00±0.28 | 0.80±0.28 | 0.71±0.01 |
TLZ | 8 | 0.82±0.04 | 1.63±0.93 | 0.50±0.05b | 0.46±0.08b | 0.58±0.02b | 1.11±0.22 | 1.17±0.49 | 0.54±0.06b |
NC | 8 | 1.00±0.32 | 1.00±0.33 | 1.00±0.22 | 1.00±0.31 | 1.00±0.03 | 1.00±0.11 | 1.00±0.21 | 1.00±0.13 |
Table 4 Effects of typical sinking Chinese medicines on sperm meiosis-related mRNA levels in the testis of normal male rats ($\bar{x}±s$)
Group | n | GnRhR | AR | SCP3 | SYCE1 | SMC1B | SMC3 | SYCP2 | REC8 |
---|---|---|---|---|---|---|---|---|---|
DX | 8 | 0.82±0.3 | 0.57±0.01 | 0.59±0.16b | 0.51±0.02b | 0.64±0.05b | 0.90±0.23 | 0.96±0.46 | 0.39±0.17b |
KXR | 8 | 0.44±0.16a | 0.58±0.03 | 0.59±0.16b | 0.63±0.11b | 0.89±0.14 | 1.36±0.16 | 0.66±0.19 | 0.37±0.10b |
CNX | 8 | 0.75±0.34 | 1.46±0.77 | 0.60±0.02b | 0.50±0.06b | 0.78±0.14b | 1.02±0.17 | 0.69±0.13 | 0.69±0.04a |
FL | 8 | 0.88±0.04 | 1.01±0.43 | 0.59±0.09b | 0.49±0.08b | 0.64±0.04b | 1.09±0.22 | 0.96±0.38 | 0.58±0.25a |
DD | 8 | 0.75±0.01 | 0.99±0.36 | 0.62±0.08b | 0.44±0.03b | 0.60±0.12b | 0.83±0.07 | 1.33±0.25 | 0.57±0.01a |
XFH | 8 | 0.50±0.12a | 1.17±0.51 | 0.57±0.05b | 0.57±0.05b | 0.67±0.02b | 1.00±0.28 | 0.80±0.28 | 0.71±0.01 |
TLZ | 8 | 0.82±0.04 | 1.63±0.93 | 0.50±0.05b | 0.46±0.08b | 0.58±0.02b | 1.11±0.22 | 1.17±0.49 | 0.54±0.06b |
NC | 8 | 1.00±0.32 | 1.00±0.33 | 1.00±0.22 | 1.00±0.31 | 1.00±0.03 | 1.00±0.11 | 1.00±0.21 | 1.00±0.13 |
Figure 3 Effects of MH and TLZ with cetrorelix on testicular coefficient and sex hormone levels in normal male rats A: testis index of each group of rats; B-D: levels of GnRH, LH, and testosterone (T) of each group of rats. MH (4.2 g/kg) and TLZ (4.2 g/kg) were administered by oral gavage for the different groups. Each antagonist group injected intraperitoneally 300 µg·kg-1·d-1 cetrorelix. The data represent the mean ± standard deviation of eight rats in each group. NC: Normal control group; NC+CE: Normal + cetrorelix group; MH: Mahuang (Herba Ephedra Sinica) group; MH+CE: Mahuang (Herba Ephedra Sinica) + cetrorelix group; TLZ: Tinglizi (Semen Lepidii Apetali) group; TLZ+CE: Tinglizi (Semen Lepidii Apetali) + cetrorelix group. The data represent the mean ± standard deviation of eight rats in each group. Compared with the normal group, aP < 0.05, bP < 0.01; compared with the MH group; cP < 0.01.
Figure 4 Effects of MH and TLZ with cetrorelix on protein levels of GnRhR, AR, and SCP3 in the testis of normal male rats using immunofluorescence assay A, B: effects of MH and TLZ with cetrorelix on protein levels of GnRhR, AR, and SCP3 in the testis of normal male rats. MH (4.2 g/kg) and TLZ (4.2 g/kg) were administered by oral gavage for the different groups. Each antagonist group injected intraperitoneally 300 µg·kg-1·d-1 cetrorelix. NC: Normal control group; NC + CE: Normal + cetrorelix group; NC: Normal control group; NC + CE: Normal + cetrorelix group; MH: Mahuang (Herba Ephedra Sinica) group; MH + CE: Mahuang (Herba Ephedra Sinica) + cetrorelix group; TLZ: Tinglizi (Semen Lepidii Apetali) group; TLZ + CE: Tinglizi (Semen Lepidii Apetali) + cetrorelix group. GnRhR: gonadotropin-releasing hormone receptor; AR: androgen receptor; SCP3: Synaptonemal complex protein 3. The data represent the mean ± standard deviation of eight rats in each group. Compared with the normal group, aP < 0.01, bP < 0.05; compared with the MH group; cP < 0.01.
Figure 5 Effects of MH and TLZ with cetrorelix on protein levels of GnRhR, AR, and SCP3 in the testis of normal male rats using Western blotting MH (4.2 g/kg) and TLZ (4.2 g/kg) were administered by oral gavage for the different groups. Each antagonist group injected intraperitoneally 300 µg·kg-1·d-1 cetrorelix. NC: Normal control group; NC+CE: Normal + cetrorelix group; NC: Normal control group; NC+CE: Normal + cetrorelix group; MH: Mahuang (Herba Ephedra Sinica) group; MH+CE: Mahuang (Herba Ephedra Sinica) + cetrorelix group; TLZ: Tinglizi (Semen Lepidii Apetali) group; TLZ+CE: Tinglizi (Semen Lepidii Apetali) + cetrorelix group. GnRhR: gonadotropin-releasing hormone receptor. The data represent the mean ± standard deviation of eight rats in each group. Compared with the normal group, aP < 0.05.
Group | n | GnRhR | AR | SCP3 | SYCE1 | SMC1B | SMC3 | SYCP2 | REC8 |
---|---|---|---|---|---|---|---|---|---|
NC | 8 | 1.00±0.30 | 1.00±0.04 | 1.00±0.07 | 1.00±0.05 | 1.00±0.07 | 1.00±0.05 | 1.00±0.23 | 1.00±0.30 |
NC+CE | 8 | 0.44±0.15a | 0.60±0.14a | 0.52±0.22b | 0.78±0.02 | 0.62±0.09a | 0.68±0.05b | 0.29±0.05b | 0.38±0.07a |
MH | 8 | 1.41±0.18b | 1.29±0.02b | 1.58±0.26a | 1.63±0.59a | 1.59±0.18a | 1.37±0.24b | 1.58±0.37a | 1.73±0.12b |
MH+CE | 8 | 0.82±0.11c | 0.70±0.12c | 1.04±0.09d | 0.57±0.30c | 1.20±0.10c | 0.65±0.23c | 0.58±0.19c | 0.71±0.34c |
TLZ | 8 | 1.04±0.07 | 0.91±0.12 | 1.02±0.29 | 0.74±0.06 | 0.61±0.01 | 0.99±0.11 | 0.89±0.26 | 0.51±0.28 |
TLZ+CE | 8 | 0.16±0.10a | 0.59±0.07a | 0.46±0.21b | 0.62±0.17 | 0.31±0.02a | 0.68±0.07b | 0.39±0.15b | 0.13±0.10a |
Table 5 Effects of MH and TLZ with cetrorelix on sperm meiosis-related mRNA levels in the testis of normal male rats ($\bar{x}±s$)
Group | n | GnRhR | AR | SCP3 | SYCE1 | SMC1B | SMC3 | SYCP2 | REC8 |
---|---|---|---|---|---|---|---|---|---|
NC | 8 | 1.00±0.30 | 1.00±0.04 | 1.00±0.07 | 1.00±0.05 | 1.00±0.07 | 1.00±0.05 | 1.00±0.23 | 1.00±0.30 |
NC+CE | 8 | 0.44±0.15a | 0.60±0.14a | 0.52±0.22b | 0.78±0.02 | 0.62±0.09a | 0.68±0.05b | 0.29±0.05b | 0.38±0.07a |
MH | 8 | 1.41±0.18b | 1.29±0.02b | 1.58±0.26a | 1.63±0.59a | 1.59±0.18a | 1.37±0.24b | 1.58±0.37a | 1.73±0.12b |
MH+CE | 8 | 0.82±0.11c | 0.70±0.12c | 1.04±0.09d | 0.57±0.30c | 1.20±0.10c | 0.65±0.23c | 0.58±0.19c | 0.71±0.34c |
TLZ | 8 | 1.04±0.07 | 0.91±0.12 | 1.02±0.29 | 0.74±0.06 | 0.61±0.01 | 0.99±0.11 | 0.89±0.26 | 0.51±0.28 |
TLZ+CE | 8 | 0.16±0.10a | 0.59±0.07a | 0.46±0.21b | 0.62±0.17 | 0.31±0.02a | 0.68±0.07b | 0.39±0.15b | 0.13±0.10a |
1 |
Zhou N, Yang Y, Li K, et al. Integrating strategies of chemistry, biochemistry and metabolomics for characterization of the medication principle of "treating cold/heat syndrome with hot/cold herbs". J Ethnopharmacol 2019; 239: 111899.
DOI URL |
2 | Ren HB, Wang YC, Ma JM, et al. Active ingredients of Ephedra and their clinical application and contraindications. Zhong Guo Yao Wu Jing Jie 2021; 18: 396-9. |
3 | Huang DF, Wei JY, Liang J, et al. Prediction and analysis of Chaihu (Bupleurum chinense) on quality marker. Zhong Hua Zhong Yi Yao Xue Kan 2021; 39: 126-32. |
4 | Li CJ, Chen DH, Xiao PG. Chemical constituents of Shengma (V). Zhong Cao Yao 1995: 288-9. |
5 | Chen Y, Wen JY, Xie XF, et al. Research progress on chemical constituents and pharmacological effects of Gegen. Zhong Yao Yu Lin Chuang 2021; 12: 53-60. |
6 | Lan PY. Research progress on the main chemical components and pharmacological effects of mint. Yi Xue Shi Liao Yu Jian Kang 2020; 18: 208-9. |
7 | Xu WC luo ZC, Xie T, et al. Advance in research on platycodonis radix and preliminary analysis of its quality marker prediction. Nanjing Zhong Yi Yao Da Xue Xue Bao 2021; 37: 294-302. |
8 | Tang YF, Zhang T, Chen C, et al. Research progress in volatile chemical constituents and medical functions of clove. Ya Tai Chuan Tong Yi Yao 2021; 17: 200-4. |
9 | Zhao YS, Hu J, Wu JS, et al. Research progress on processing methods and pharmacological effects of kuxingren (Armeniacae Semen amarum). Zhong Yi Yao Dao Bao 2021; 27: 175-180. |
10 | Shi CJ, Wang SS, Cheng ZQ, et al. Comparison of chemical constituents between Cyathula offinalis and adulterant and their admixture by HPLC characteristic chromatogram fingerprint combined with chemometrics. Zhong Guo Zhong Yao Za Zhi 2018; 43: 2313-20. |
11 | Feng BW, Chen SN, Cheng QX, et al. Exploring the relationship between quality of Poria and geographical origins by chemical pattern recognition combined with characteristic fingerprint and content of triterpene acids. Zhong Yao Xin Yao Yu Lin Chuang Yao Li 2021; 32: 1506-12. |
12 | Li N, Li X, Feng ZG, et al. Chemical constituents of Canavaliae Semen. Shen Yang Yao Ke Da Xue Xue Bao 2007; 11: 676-8. |
13 | He GY, Li G, Geng HM. Research progress of Inuleae Flos. Zhong Guo Yi Xue Chuang Xin 2012; 9: 161-3. |
14 | Wang L, Li HW. Study on HPLC fingerprint of Semen Lepidii Apetali before and after frying. Tianjin Zhong Yi Yao 2020; 37: 704-10. |
15 | Liu MT, Xu JX, Li Z, et al. Study on specific chromatogram of Ligusticum chuanxiong Hort. by UPC. Zhong Cao Yao 2021; 52: 6032-37. |
16 | Yan FP. Study on application of Zhang yuansu’s ascending and descending theory in the compatibility of Traditional Chinese Medicine prescription. Heilongjiang: Heilongjiang TCM University, 2020; 1-54. |
17 | Mu J, Zhang S, Tang F, et al. Mechanism underlying effect of Chaihu Shugan San on major depressive disorder: a network pharmacology-based study. J Tradit Chin Med 2021; 41: 338-48. |
18 |
Dong WJ, Chen JS. Antagonistic effect of radix Puerariae on the ototoxicity of sodium ethocrynate. An experimental study. J Tradit Chin Med 1984; 4: 229-32.
PMID |
19 | Qin RL, Wang DP, Lu ZN. Study on anti-inflammatory analgesia and antibacterial effect of the soup in vitro. Tong Hua Shi Fan Xue Yuan Xue Bao 2018; 39: 9-13. |
20 | Chen SL, Li Q, Dou GL. Textual research about cohosh and Radix bupleuri are Key herbs of Buzhong Yiqi Tang. Shi Zhen Guo Yi Guo Yao 2018; 29: 2711-13. |
21 | Song N, Wang Q, Bai YL, et al. Clinical application and dosage of Herba Menthae. Jilin Zhong Yi Yao 2020; 40: 1225-27. |
22 | Dai J. Application of the theory of Chinese medicinal meridian entry and channel envoy medicinals in formula formation. Heilongjiang: Heilongjiang TCM University, 2018; 1-74. |
23 | Wu Q, Du LJ, Tan YM, et al. Treatment of endocrinic metabolic disease based on qi transformation theory and new use of Wuling powder. Shi Jie Zhong Yi Yao 2021: 1-4. |
24 | Zeng M, Li M, Zhang L, et al. Different meridian tropism in three Chinese medicines: Tinglizi (Semen Lepidii Apetali), Yiyiren (Semen Coicis), Cheqianzi (Semen Plantaginis). J Tradit Chin Med 2019; 39: 213-20. |
25 | Zhao J, Wang HH, Ou YY, et al. Explore effective constituents and mechanism of Tingli Dazao Xiefeitang in treatment of heart failure based on network pharmacology and mass spectrometry. Zhong Guo Shi Yan Fang Ji Xue Za Zhi 2021; 27: 151-60. |
26 | Wang GM, Chen YQ, Liu WL. Application of flower drugs in regulation of spleen and stomach qi movement. Zhong Yi Za Zhi 2015; 56: 176-7. |
27 | Zhang Y. The clinical effect of town liver quenching soup in treating cerebral infarction. Hang Kong Hang Tian Yi Xue Za Zhi 2021; 32: 207-8. |
28 | Chen GR, Chen FH, Ge JF, et al. The protective effect of Pueraria lobata flavonoids on osteoporosis in ovariectomized rats. Anhui Yi Ke Da Xue Xue Bao 2014; 49: 759-4. |
29 | Qi LG, Erden Qimuge, Wu F, et al. Puerarin alleviates the reproductive damage induced by diethylstilbestrol in male mice. Heilongjiang Chu Mu Shou Yi 2013: 148-50. |
30 |
Cheng XQ, Li H, Yue XL, et al. Macrophage immunomodulatory activity of the polysaccharides from the roots of Bupleurum smithii var. parvifolium. J Ethnopharmacol 2010; 130: 363-8.
DOI URL |
31 |
Dong Z, Zhang M, Li H, Zhan Q, Lai F, Wu H. Structural characterization and immunomodulatory activity of a novel polysaccharide from Pueraria lobata (Willd.) Ohwi root. Int J Biol Macromol 2020; 154: 1556-64.
DOI URL |
32 |
Smith MJ, Germolec DR, Frawley RP, White KL, Jr. Immunomodulatory effects of black cohosh (Actaea racemosa) extract in female B6C3F1/N mice. Toxicology 2013; 308: 146-57.
DOI URL |
33 | Fan WJ, Li CJ, Chen L, et al. Progress in the research and application of gonadotropin-releasing hormone. Heilongjiang Dong Wu Fan Zhi 2020; 28: 23-30. |
34 | Zhao Xj. Research on the Effect of gonadotropin-releasing hormone antagonist in preventing chemeotherapy-induced POF. Xi an: Di Si Jun Yi University; 2011; 1-143. |
35 |
Cheng CY, Wong EW, Yan HH, Mruk DD. Regulation of spermatogenesis in the microenvironment of the seminiferous epithelium: new insights and advances. Mol Cell Endocrinol 2010; 315: 49-56.
DOI PMID |
36 | Ma HT, Niu ZM, Guo JQ, et al. Progress in the genes regulating meiosis during spermatogenesis. Sheng Zhi Yi Xue Za Zhi 2016; 25: 865-9. |
37 |
Eijpe M, Heyting C, Gross B, Jessberger R. Association of mammalian SMC1 and SMC3 proteins with meiotic chromosomes and synaptonemal complexes. J Cell Sci 2000; 113: 673-82.
DOI URL |
38 |
Mannini L, Cucco F, Quarantotti V, et al. SMC1B is present in mammalian somatic cells and interacts with mitotic cohesin proteins. Sci Rep 2015; 5: 18472-83.
DOI PMID |
39 | Jiang HW, Jiang XH, Ye JW, et al. Synaptonemal complex: the fundamental structure of meiosis. Sheng Li Xue Bao 2020; 72: 84-90. |
40 | Yang Y, Li ZS, Dong WT, et al. Cloning of SYCE1 gene in sheep (Ovisaries) and its expression male reproductive axis. Xi Bei Nong Lin Ke Ji Da Xue Xue Bao 2020; 48: 1-8. |
41 | Lin HY, Zhang WL, Zhang YQ, et al. Third generation gonadotropin releasing hormone antagonist: cetrorelix. Guo Ji Fu Chan Ke Xue Za Zhi 2008; 3: 207-10. |
No related articles found! |
Viewed | ||||||
Full text |
|
|||||
Abstract |
|
|||||
Sponsored by China Association of Chinese Medicine
& China Academy of Chinese Medical Sciences
16 Nanxiaojie, Dongzhimen Nei, Beijing, China. 100700 Email: jtcmen@126.com
Copyright 2020 Journal of Traditional Chinese Medicine. All rights reserved.