Efficacy of aqueous extract of flower of Edgeworthia gardneri (Wall.) Meisn on glucose and lipid metabolism in KK/Upj-Ay/J mice

doi:10.19852/j.cnki.jtcm.20220218.001

Abstract

Abstract:

OBJECTIVE: To observe the effects of the flower of Edgeworthia gardneri (Wall.) Meisn (EWM) on glucose and lipid metabolism in KK/upj-Ay/J (KKAy) mice and investigate the possible mechanism of EWM in the liver of KKAy mice by transcriptome analysis.

METHODS: Forty KKAy mice were fed a high-sugar and high-fat diet for 3 weeks to establish the animal model of metabolic syndrome. After 5 weeks of continuous administration of EWM, serum high-density lipoprotein (HDL), low-density lipoprotein (LDL), triglycerides (TG), total cholesterol (TC), and free fatty acids (FFA) were detected by radioimmunoassay. Serum fasting insulin (Fins) and adiponectin levels were measured by enzyme-linked immunosorbent assay. Liver tissue fixed with paraformaldehyde was stained with hematoxylin-eosin and oil red O. Transcriptome analysis was used to evaluate the liver tissue. The expressions of lipoprotein lipase (LPL), peroxisome proliferator-activated receptor-γ (PPARγ), adenosine 5‘-monophosphate-activated protein kinase (AMPK), sterol regulatory element binding protein-1c (SREBP-1c), and fatty acid synthase (Fas) mRNA and protein in liver tissue were detected by reverse transcription-polymerase chain reaction (RT-PCR) and Western blot analysis.

RESULTS: EWM slightly reduced FBG and Fins in KKAy mice. Furthermore, EWM was able to downregulate serum LDL, TG, TC, and FFA and upregulate the expression of serum HDL and adiponectin. Transcriptome analysis revealed the following differential pathways: the peroxisome proliferator-activated receptor (PPAR) signaling pathway and the AMPK signaling pathway. RT-PCR and western blot analysis detected the associated genes and proteins. In addition, EWM was able to upregulate the expression of AMPK and downregulate the expression of PPARγ, SREBP1c, and Fas mRNA and protein and upregulate the expression of LPL mRNA.

CONCLUSIONS: EWM can alleviate lipid metabolism disorders and to some extent improve glucose metabolism disorders in KKAy mice. These effects may be related to regulating PPARγ/LPL and activating the AMPK/SREBP1c/Fas pathway.

Key words: transcriptome, PPAR gamma, AMP-activated protein kinases, Edgeworthia gardneri (Wall.) Meisn flower

ZHANG Chengfei, QIN Lingling, WANG Haiyan, SUN Boju, ZHAO Dan, ZHANG Qiue, ZHONG Fengying, WU Lili, LIU Tonghua. Efficacy of aqueous extract of flower of Edgeworthia gardneri (Wall.) Meisn on glucose and lipid metabolism in KK/Upj-Ay/J mice[J]. Journal of Traditional Chinese Medicine, 2022, 42(2): 187-193.

Figures/Tables 7

Table 1 Primer list

Gene	Forward primer (5→3)	Reverse primer (5→3)	Temperature (℃)
PPARγ	GCATTTCTGCTCCACACTAT	ACTTTGATCGCACTTTGGTA	60
AMPK	TCTATGAACTGGAGGAGCACA	GAAATGCAGACAAGTGGCTTA	60
SREBP-1c	GCTACCGGTCTTCTATCAATGA	CGCAAGACAGCAGATTTATTCA	60
Fas	TGTGACCACTGTGAGAAGCA	CTCCTCTTCCAAGCAACCTC	60
LPL	GAGTTGTAGAAAGAATCGCTGT	TCTGAGAGCGAGTCTTCAGGTA	60
GAPDH	TGCGACTTCAACAGCAACTC	ATGTAGGCAATGAGGTCCAC	60

Table 2 Changes of FBG in mice of each group ($\bar{x}±s$)

Group	n	0 W	1 W	2 W	3 W	4 W	5 W
C57	10	4.1±0.8	3.6±0.3	4.0±0.6	4.29±0.5	4.1±0.6	3.9±0.7
KKAy	10	5.9±0.9^b	7.0±0.7^b	8.2±1.4^b	10.2±1.2^b	11.2±1.2^b	14.4±1.5^b
KKAy+M	10	5.9±1.0	6.7±0.9	7.3±0.7^c	7.8±1.2^d	8.2±1.1^d	9.7±0.9^d
KKAy+A-L	10	5.9±1.0	7.0±1.0	8.0±0.9	9.6±1.5^e	10.1±1.1^cf	13.4±1.2^cf
KKAy+A-M	10	5.9±0.9	6.8±1.0	7.4±0.8	8.7±1.4	9.2±0.9^de	11.0±1.0^de

Table 3 Results of blood lipid of mice in each group ($\bar{x}±s$)

Group	n	HDL (mmol/L)	LDL (mmol/L)	TC（mmol/L)	TG（mmol/L)	FFA (mmol/L)	Adiponectin （μg/mL)
C57	6	2.13±0.20	0.25±0.01	2.25±0.20	2.19±0.18	0.20±0.03	9.30±0.71
KKAy	6	1.63±0.16^b	0.27±0.02	2.94±0.15^b	2.99±0.20^b	0.43±0.02^b	6.11±1.02^b
KKAy+M	6	1.73±0.08	0.30±0.02	2.74±0.21	2.77±0.25	0.33±0.07^c	6.72±1.19
KKAy+A-L	6	1.82±0.14	0.29±0.03	2.74±0.26	2.80±0.27	0.39±0.12	6.95±1.10
KKAy+A-M	6	1.96±0.03^c,e	0.25±0.02^f	2.47±0.18^d,f	2.39±0.20^d,f	0.34±0.05^c	7.54±1.40^c

Figure 1 Light microscope observation results of HE staining and oil red O staining of mice liver (× 200) A1, A2: C57 group; B1, B2: KKAy group; C1, C2: KKAy+M group; D1, D2: KKAy+A-L group; E1, E2: KKAy+A-M group. Paraffin sections were subjected to hematoxylin-eosin (HE) staining (10×20), frozen sections were subjected to oil red O staining (10 × 20). C57BL/6J mice + ultrapure water: C57 group; KK/upj-Ay/J mice + ultrapure water: KKAy group; KKAy + metformin (1.0 g/kg): KKAy + M group; KKAy + aqueous extract of EWM low-dose (0.134 g/kg): KKAy + A-L group; KKAy + aqueous extract of EWM medium-dose (0.268 g/kg): KKAy + A-M group. These three groups were administered by gavage for 5 weeks.

Figure 2 Bubble diagram of top 20 KEGG enrichment analysis pathways Caption: the x-axis displays the enrichment score. The larger the bubble, the greater the number of differential protein-coding genes. The color of the bubble changes from purple-blue-green-red. The smaller the enrichment P-value, the greater the significance.

Figure 3 Relative expression of mRNA ($\bar{x}±s$, n = 5) KK/upj-Ay/J mice + ultrapure water: KKAy group; KKAy + aqueous extract of EWM low-dose (0.134 g/kg): KKAy + A-L group; KKAy + aqueous extract of EWM medium-dose (0.268 g/kg): KKAy + A-M group. PPARγ: peroxisome proliferator-activated receptor-γ; AMPK: AMP-activated protein kinase; SREBP-1c: sterol regulatory element binding protein-1c; Fas: fatty acid synthase; LPL: lipoprotein lipase. aP < 0.01 and bP < 0.05 vs KKAy group.

Figure 4 Protein expression in liver tissue of mice in each group ($\bar{x} ± s$, n = 5) A: protein expression bands in liver tissue of mice in each group; B: protein expression level in liver tissue of mice in each group. C57BL/6J mice + ultrapure water: C57 group; KK/upj-Ay/J mice + ultrapure water: KKAy group; KKAy + aqueous extract of EWM low-dose (0.134 g/kg): KKAy + A-L group; KKAy + aqueous extract of EWM medium-dose (0.268 g/kg): KKAy + A-M group. PPARγ: peroxisome proliferator-activated receptor-γ; AMPK: AMP-activated protein kinase; SREBP-1c: sterol regulatory element binding protein-1c; Fas: fatty acid synthase; β-actin: beta-actin. bP < 0.01 vs C57 group; cP < 0.05 vs KKAy group.

References 18.

1.	Rader DJ. Effect of insulin resistance, dyslipidemia, and intra-abdominal adiposity on the development of cardiovascular disease and diabetes mellitus. Am J Med 2007; 120: S12-8.
2.	Nolan PB, Carrick-Ranson G, Stinear JW, et al. Prevalence of metabolic syndrome and metabolic syndrome components in young adults: apooled analysis. Prev Med Rep 2017; 7: 211-5. DOI PMID
3.	Tanaka N, Kimura T, Fujimori N, et al. Current status, problems, and perspectives of non-alcoholic fatty liver disease research. World J Gastroenterol 2019; 25: 163-77. DOI URL
4.	Younossi ZM, Koenig AB, Abdelatif D, et al. Global epidemiology of nonalcoholic fatty liver disease-Meta-analytic assessment of prevalence, incidence, and outcomes. Hepatology 2016; 64: 73-84. DOI PMID
5.	Zhang Z, Xu H, Zhao H, et al. Edgeworthia gardneri (Wall.) Meisn. water extract improves diabetes and modulates gut microbiota. J Ethnopharmacol 2019; 239: 111854. DOI URL
6.	Gao D, Zhang YL, Yang FQ, et al. The flower of Edgeworthia gardneri (wall.) Meisn. suppresses adipogenesis through modulation of the AMPK pathway in 3T3-L1 adipocytes. J Ethnopharmacol 2016; 191: 379-86. DOI URL
7.	Wang H, Qin L, Wang D, et al. Mixture of five herbal extracts ameliorates pioglitazone-induced aggravation of hepatic steatosis via activating the adiponectin receptor 2/AMP-activated protein kinase signal pathway in diabetic KKAy mice. J Tradit Chin Med 2017; 37: 588-98. DOI URL
8.	Li Y, He PP, Zhang DW, et al. Lipoprotein lipase: from gene to atherosclerosis. Atherosclerosis 2014; 237: 597-608. DOI URL
9.	McCoy MG, Sun GS, Marchadier D, et al. Characterization of the lipolytic activity of endothelial lipase. J Lipid Res 2002; 43: 921-9. PMID
10.	Gross B, Pawlak M, Lefebvre P, Staels B. PPARs in obesity-induced T2DM, dyslipidaemia and NAFLD. Nat Rev Endocrinol 2017; 13: 36-49. DOI URL
11.	Hu S, Shen G, Zhao W, et al. Paeonol, the main active principles of Paeonia moutan, ameliorates alcoholic steatohepatitis in mice. J Ethnopharmacol 2010; 128: 100-6. DOI URL
12.	Dubois V, Eeckhoute J, Lefebvre P, et al. Distinct but complementary contributions of PPAR isotypes to energy homeostasis. J Clin Invest 2017; 127: 1202-14. DOI URL
13.	Ruderman NB, Carling D, Prentki M, et al. AMPK, insulin resistance, and the metabolic syndrome. J Clin Invest 2013; 123: 2764-72. DOI PMID
14.	Yu X, McCorkle S, Wang M, et al. Leptinomimetic effects of the AMP kinase activator AICAR in leptin-resistant rats: prevention of diabetes and ectopic lipid deposition. Diabetologia 2004; 47: 2012-21. PMID
15.	Smith BK, Marcinko K, Desjardins EM, et al. Treatment of nonalcoholic fatty liver disease: role of AMPK. Am J Physiol Endocrinol Metab 2016; 311: E730-40. DOI URL
16.	Li Y, Xu S, Mihaylova MM, et al. AMPK phosphorylates and inhibits SREBP activity to attenuate hepatic steatosis and atherosclerosis in diet-induced insulin-resistant mice. Cell Metab 2011; 13: 376-88. DOI URL
17.	Sanders FW, Griffin JL. De novo lipogenesis in the liver in health and disease: more than just a shunting yard for glucose. Biol Rev Camb Philos Soc 2016; 91: 452-68. DOI URL
18.	Menendez JA, Vazquez-Martin A, Ortega FJ, et al. Fatty acid synthase: association with insulin resistance, type 2 diabetes, and cancer. Clin Chem 2009; 55: 425-38. DOI PMID

[1]	YIN Yixiao, TANG Hao, FANG Yi, LIU Wei, WANG Jun, HU Yiyang, PENG Jinghua. Hepatic transcriptome delineates the therapeutic effects of Sanren Tang (三仁汤) on high-fat diet-induced non-alcoholic fatty liver disease [J]. Journal of Traditional Chinese Medicine, 2023, 43(6): 1092-1102.
[2]	LIU Bingbing, LI Jieru, SI Jianchao, CHEN Qi, YANG Shengchang, JI Ensheng. Ginsenoside Rb1 alleviates chronic intermittent hypoxia-induced diabetic cardiomyopathy in db/db mice by regulating the adenosine monophosphate-activated protein kinase/Nrf2/heme oxygenase-1 signaling pathway [J]. Journal of Traditional Chinese Medicine, 2023, 43(5): 906-914.
[3]	QU Dongxiao, GE Yiqin, ZHUO Limin, CHEN Liji, XUE Yonghua, CHENG Jiwei, TAO Jie, LI Guoyi, ZHU Yudan, XIAO Qian. Efficacy and mechanisms of Dingxian pill (定痫丸) combined with valproic acid on pentylenetetrazol-induced chronic epilepsy in rats [J]. Journal of Traditional Chinese Medicine, 2023, 43(2): 286-294.
[4]	FAN Xiaoyan, LI Mingzhe, CHEN Long, LIANG Chao, LU Wenli, PAN Zhiqiang, JIA Dongwei, PENG Peike, FANG Zhaoqin, LIU Xiaomei. Transcriptome profile and its partly verification of human hepatocellular carcinoma cells exposed to Yuzhizi (Fructus Akebiae Quinatae) seed extract [J]. Journal of Traditional Chinese Medicine, 2022, 42(6): 922-931.
[5]	YANG Jiayao, TAO Dongqing, MA Wei, LIU Song, LIAO Yan, SHU Lei, ZHANG Shu, LI Chenyu, DU Nianlong. Protective effects and mechanisms of Lizhong decoction (理中汤) against non-alcoholic fatty liver disease in a rat model [J]. Journal of Traditional Chinese Medicine, 2022, 42(5): 773-780.
[6]	ZHANG Jiri Mutu, LIANG Shilong, NIE Peng, LIAO Yong’an, AI Qinying, YAN Xiaojun, LIU Hongning, JI Yanhua, ZENG Zhijun. Efficacy of Kushen decoction (苦参汤) on high-fat-diet-induced hyperlipidemia in rats [J]. Journal of Traditional Chinese Medicine, 2022, 42(3): 364-371.
[7]	ZHAO Zhiyue, SHI Zhenyu, ZHANG Zhenzhen, LI Yinghong, ZENG Xiaohui, CHEN Yuxing, YAO Nan, ZHOU Min, SU Hui, WANG Qinghai, JIN LiLi. Anti-hypertensive and endothelia protective effects of Fufang Qima capsule(复方芪麻胶囊) on primary hypertension via adiponectin/adenosine monophosphate activated protein kinase pathway [J]. Journal of Traditional Chinese Medicine, 2021, 41(6): 919-926.
[8]	LIU Wenjun, XU Xinzhu, DUAN Zhiyuan, LIANG Xicai, MA Dan, LI Gege, XIE Xin, CHAI Jiyan, CHEN Jing, SHAN Dehong. Efficacy of Sijunzi decoction (四君子汤) on limb weakness in spleen Qi deficiency model rats through adenosine monophosphate-activated protein kinase/unc-51 like autophagy activating kinase 1 signaling [J]. Journal of Traditional Chinese Medicine, 2021, 41(4): 617-623.
[9]	Wang Jianxing, Yu Xiaohan, Jiang Yan, Wang Yan, Li Ying, Han Shuying. Effects of a fermented buckwheat flower and leaf extract on the blood glucose and lipid profile of type 2 diabetic db/db mice [J]. Journal of Traditional Chinese Medicine, 2020, 40(2): 197-203.
[10]	Wang Haiyan, Li Linyi, Qin Lingling, Wang Dongchao, Jiang Yueying, Wu Xinli, Xu Tunhai, Liu Tonghua. Mixture of five herbal extracts ameliorates pioglitazone-induced aggravation of hepatic steatosis via activating the adiponectin receptor 2/AMP-activated protein kinase signal pathway in diabetic KKAy mice [J]. Journal of Traditional Chinese Medicine, 2017, 37(05): 588-598.
[11]	Wu Jiangong, Chen Xi, Guo Shuwen, Liu Wenchen, Zhang Lu, Li Fanghe, Wu Jiani, Huang Xiaolou, Cai Qian, Tan Xiaobo, Wang Hui. Effect of Yiqihuoxue prescription on myocardial energy metabolism after myocardial infarction via cross talk of liver kinase B1-dependent Notch1 and adenosine 5'-monophosphate-activated protein kinase [J]. Journal of Traditional Chinese Medicine, 2017, 37(03): 378-386.
[12]	Wang Yan, Wang Xiaozhong, Zeng Binfang, Guo Feng, He Yongquan, He Jiaying, Liu Bin. Association between peroxisome proliferator-activated receptor γ gene polymorphism and susceptibility to northwest dryness syndrome [J]. Journal of Traditional Chinese Medicine, 2017, 37(02): 201-206.
[13]	Xiaomei Liu, Zhaoqin Fang, Zhiqiang Pan, Wenli Lu, Zhonghua Wu, Chao Liang, Yuanyuan Zhang. Pituitary transcriptome profile of liver cancer mice with different syndromes reveals the relevance of pituitary to the cancer and syndromes [J]. Journal of Traditional Chinese Medicine, 2014, 34(06): 691-698.

Home

Online First

Author Center

Reviewer Center

Issues

Announcement

About Us