Efficacy of electroacupunture at Zusanli (ST36) on jumping-injured muscle based on transcriptome sequencing and genes analysis

doi:10.19852/j.cnki.jtcm.20221121.001

Abstract

Abstract:

OBJECTIVE: To reveal the efficacy and possible mechanism of electroacupuncture at Zusanli (ST36) on injured skeletal muscle induced by jumping load.

METHODS: In the present study, female Sprague-Dawley rats were randomly divided into four groups with 6 of each, including normal control group (NC), jumping-induced muscle injury model group (JI), JI with electroacupuncture stimulation treatment group (EA), and JI with non-electroacupuncture stimulation group (NEA). Transmission electron microscopy, transcriptome sequencing and analysis, prediction of protein interaction networks, real-time polymerase chain reaction verification, and Western blotting were performed on the gastrocnemius muscle of ipsilateral lower limbs.

RESULTS: The structural repair of injured gastrocnemius myofibers following jumping training in EA rats was better than that of NEA rats. A total of 136 genes were differentially expressed in EA rats relative to JI rats, with 55 genes upregulated and 81 genes downregulated. According to results of transcriptome analysis, and prediction of protein mutual interaction by the online STRING database, Heat shock protein beta-7 (Hspb7) and myozenin2 (Myoz2) genes were targeted. Expressions of Hspb7 and Myoz2 mRNAs were increased in EA rats relative to JI rats (P < 0.05). The expression of Hspb7 protein was upregulated in EA rats relative to that in NC, JI, and NEA rats (P < 0.01, < 0.05, and < 0.05, respectively). The expression of Myoz2 protein was upregulated in EA rats relative to that in NC and JI rats (both P < 0.01, respectively).

CONCLUSIONS: The present results suggest that electroacupuncture stimulation at Zusanli (ST36) could improve muscle healing following jumping-induced muscle injury, owing to the upregulation of Hspb7 and Myoz2 proteins.

Key words: electroacupuncture stimulation, skeletal muscle, wounds and injuries, gene expression profiling, sequence analysis, Hspb7, Myoz2

HAN Rui, CHANG Junzhao, LIU Qianqian, LIU Haitao, LI Junwei. Efficacy of electroacupunture at Zusanli (ST36) on jumping-injured muscle based on transcriptome sequencing and genes analysis[J]. Journal of Traditional Chinese Medicine, 2023, 43(2): 322-328.

Figures/Tables 6

Figure 1 Ultra-microstructure of gastrocnemius muscle from four groups A-D: images of the group NC, JI, EA, and NEA, respectively (2.0 μM，× 2.5k). NC: normal control group; JI: jumping-induced muscle injury model group; EA: JI with electroacupuncture stimulation treatment group; NEA: JI with non-electroacupuncture stimulation group; black arrow: M line malalignment; white arrow: Z line malalignment; green arrow: swollen mitochondria; blue arrows: autophagosome; yellow arrows: mitochondrial vacuoles; red arrows: normal mitochondria with different shapes.

Figure 2 Targeting key genes of the jumping-injured muscle in response to electroacupuncture at Zusanli (ST36) A: MA plot showing differentially expressed mRNA level; B: Go annotation of differentially expressed genes; C: KEGG enrichment for differentially expressed genes; D: interaction network prediction of Hspb7 protein in rats. red dots: upregulated genes; green dots: downregulated genes. FPKM: fragments per kilobase million; FC: fold change; KEGG: Kyoto Encyclopedia of Genes and Genomes.

Table 1 Transcriptome analysis results of target genes

Gene ID	Gene Name	FDR	log2FC	Regulated (JI vs EA)
ENSRNOG00000029079	Hspb7	1.37E-99	1.558272	up
ENSRNOG00000014815	Myoz2	1.31E-47	1.041293	up

Table 2 Primer sequences of factors to improve regeneration and repair

Primer name	Primer sequence (5'-3')	Product lengths (bp)
R-GAPDH-S	CTGGAGAAACCTGCCAAGTATG	138	60
R-GAPDH-A	GGTGGAAGAATGGGAGTTGCT	138	60
R-Hspb7-S	CGGGGGACAAGGAAACATCA	182	60
R-Hspb7-A	CTGGTAGCTGGCACTTGTGA	182	60
R- Myoz2-S	GACTTCGAACGACTGCTGCTAAC	164	60
R- Myoz2-A	TCTGACTCTGGCATAGTGACATCTT	164	60

Table 3 Effects of electroacupunture at Zusanli (ST36) on mRNA expressions of injured muscle ($\bar{x}\pm s$)

Group	n	Hspb7	Myoz2
JI	3	1.00±0.28	1.00±0.84
EA	3	1.88±0.46^a	3.51±0.87^a
P value		0.048	0.023

Figure 3 Expressions of target proteins in rats After confirming that transcriptome sequencing results are accurate and reliable, expressions of Hspb7 and Myoz2 proteins were detected in gastrocnemius. A: The fold change in relative expression of target proteins to the internal control protein was shown. Data are represented as the mean ± standard deviation for three experiments per group. Compared with the NC group, aP < 0.05, bP < 0.01; compared with the JI group, cP < 0.05, eP < 0.01; compared with the NEA group, dP < 0.05. B: Target protein bands were shown by using Western blotting. GAPDH used as an internal control. NC: normal control group; JI: jumping-induced muscle injury model group; EA: JI with electroacupuncture stimulation treatment group; NEA: JI with non-electroacupuncture stimulation group; Hspb7: heat shock protein beta-7; Myoz2: Myozenin2; GAPDH: glyceraldehyde-3-phosphate dehydrogenase.

References 33.

1.	Kim W, Kim J, Park HS, et al. Development of microfluidic stretch system for studying recovery of damaged skeletal muscle cells. Micromachines (Basel) 2018; 9: 671.
2.	Relaix F, Zammit PS. Satellite cells are essential for skeletal muscle regeneration: the cell on the edge returns centre stage. Development 2012; 139: 2845-56. DOI PMID
3.	Brooks SV. Current topics for teaching skeletal muscle physiology. Adv Physiol Educ 2003; 27: 171-82. DOI PMID
4.	Vickers AJ, Vertosick EA, Lewith G, et al. Acupuncture Trialists' Collaboration. Acupuncture for chronic pain: update of an individual patient data meta-analysis. J Pain 2018; 19: 455-74. DOI PMID
5.	Bassett AJ, Ahlmen A, Rosendorf JM, et al. The biology of sex and sport. JBJS Rev 2020; 8: e0140. DOI URL
6.	Cross KM, Gurka KK, Saliba S, et al. Comparison of thigh muscle strain occurrence and injury patterns between male and female high school soccer athletes. J Sport Rehabil 2018; 27: 451-9. DOI PMID
7.	Ross JL, Queme LF, Lamb JE, et al. Sex differences in primary muscle afferent sensitization following ischemia and reperfusion injury. Biol Sex Differ 2018; 9: 2. DOI PMID
8.	Liu H, Gao F, Liang X, et al. Pathogenesis and development of patellar tendon fibrosis in a rabbit overuse model. Am J Sports Med 2020; 48: 1141-50. DOI PMID
9.	Laumonier T, Menetrey J. Muscle injuries and strategies for improving their repair. J Exp Orthop 2016; 3: 15. DOI PMID
10.	Yin CS, Jeong HS, Park HJ, et al. A proposed transpositional acupoint system in a mouse and rat model. Res Vet Sci 2008; 84: 159 -65. DOI PMID
11.	Zou D, Chen Y, Liu T, et al. Effects of electroacupuncture at "Weizhong" (BL40) on morphology and expression of CK and IL-17 in rats with bupivacaine-induced multifidus muscle injury. Zhong Guo Zhen Jiu 2017; 37: 971-6.
12.	Zhongren Li. Experimental acupuncture. 2nd ed. Beijing: China Press of Traditional Chinese Medicine, 2007: 206-11.
13.	Zininga T, Ramatsui L, Shonhai A. Heat shock proteins as immuno-modulants. Molecules 2018; 23: 2846. DOI URL
14.	Mymrikov EV, Seit-Nebi AS, Gusev NB. Large potentials of small heat shock proteins. Physiol Rev 2011; 91: 1123-59. DOI PMID
15.	Koike N, Hatano Y, Ushimaru T. Heat shock transcriptional factor mediates mitochondrial unfolded protein response. Curr Genet 2018; 64: 907-17. DOI PMID
16.	Mymrikov EV, Seit-Nebi AS, Gusev NB. Large potentials of small heat shock proteins. Physiol Rev 2011; 91: 1123-59. DOI PMID
17.	Kennedy D, Mnich K, Samali A. Heat shock preconditioning protects against ER stress-induced apoptosis through the regulation of the BH3-only protein BIM. FEBS Open Bio 2014; 4: 813-21. DOI PMID
18.	Taylor RP, Benjamin IJ. Small heat shock proteins: a new classification scheme in mammals. J Mol Cell Cardiol 2005; 38: 433-44. DOI PMID
19.	Muranova LK, Shatov VM, Bukach OV, et al. Cardio-vascular heat shock protein (cvHsp, HspB7), an unusual representative of small heat shock protein family. Biochemistry (Mosc) 2021; 86: S1-11. DOI
20.	Jin C, Shuai T, Tang Z. HSPB7 regulates osteogenic differentiation of human adipose derived stem cells via ERK signaling pathway. Stem Cell Res Ther 2020; 11: 450. DOI
21.	Rüdebusch J, Benkner A, Poesch A, et al. Dynamic adaptation of myocardial proteome during heart failure development. PLoS One 2017; 12: e0185915. DOI URL
22.	Juo LY, Liao WC, Shih YL, et al. HSPB7 interacts with dimerized FLNC and its absence results in progressive myopathy in skeletal muscles. J Cell Sci 2016; 129: 1661-70.
23.	Wu T, Mu Y, Bogomolovas J, et al. HSPB7 is indispensable for heart development by modulating actin filament assembly. Proc Natl Acad Sci USA 2017; 114: 11956-61. DOI PMID
24.	Sun X, Li X, Jia H, et al. Effect of heat-shock protein B7 on oxidative stress in adipocytes from preruminant calves. J Dairy Sci 2019; 102: 5673-85. DOI PMID
25.	Yin H, Price F, Rudnicki MA. Satellite cells and the muscle stem cell niche. Physiol Rev 2013; 93: 23-67. DOI PMID
26.	Cosentino M, Musarò A. Mechanisms regulating muscle regeneration: insights into the interrelated and time-dependent phases of tissue healing. Cells 2020; 9: 1297. DOI URL
27.	Li YF, Zhu GY, Ma Y, et al. Expression and prognosis of MYOZ2 in gastric cancer. Eur Rev Med Pharmacol Sci 2018; 22: 5920-27.
28.	Wu YQ, Li WX, Yang S, et al. Myoz2 promoted adipogenic differentiation of C3H10T1/2 Cells by negatively regulating the expression of TCAP. Zhong Guo Sheng Wu Hua Xue Yu Fen Zi Sheng Wu Xue Bao 2021; 37: 380-90.
29.	Wang H, Zhu Z, Wang H, et al. Characterization of different expression patterns of calsarcin-1 and calsarcin-2 in porcine muscle. Gene 2006; 374: 104-11. PMID
30.	Hoffman A, Taleski G, Sontag E. The protein serine/threonine phosphatases PP2A, PP1 and calcineurin: a triple threat in the regulation of the neuronal cytoskeleton. Mol Cell Neurosci 2017; 84: 119-31. DOI PMID
31.	La G, Zhou M, Lim JY, et al. Proteomics and transcriptomics analysis reveals clues into the mechanism of the beneficial effect of electrical stimulation on rat denervated gastrocnemius muscle. Cell Physiol Biochem 2019; 52: 769-86. DOI PMID
32.	Lee FX, Houweling PJ, North KN, et al. How does α-actinin-3 deficiency alter muscle function? Mechanistic insights into ACTN3, the 'gene for speed'. Biochim Biophys Acta 2016; 1863: 686-93. DOI PMID
33.	Wang YN, Yang WC, Li PW, et al. Myocyte enhancer factor 2A promotes proliferation and its inhibition attenuates myogenic differentiation via myozenin 2 in bovine skeletal muscle myoblast. PLoS One 2018; 13: e0196255. DOI URL

[1]	ZHANG Qiongzhi, FU Tingting, DAI Jianing, ZHOU Zhinan, SHEN Cuizhen. Sodium Danshensu promotes the healing of stage 2 pressure injury wounds in ischemia/reperfusion injury rat models: possible regulation of apoptosis and inflammatory response [J]. Journal of Traditional Chinese Medicine, 2021, 41(4): 571-580.
[2]	Chi Ho Lee, Jeong June Choi, Joo Hye Sim, Younmin Shin, Seung-Joon Oh, Ji-Hyang Gu, Hyun Ju Ha, Dong Hwi Jeon, Eun-Jung Lee, Min-Seok Oh. Gyejibokryeong-Hwan improves recovery of injured muscles in mouse model of muscle contusion [J]. Journal of Traditional Chinese Medicine, 2021, 41(3): 406-413.
[3]	Guo Yan, Lu Juan, Liang Jingrong, Zhao Ruili, Xu Jing, Zhang Wei, Park Kibeum, Zhu Shipeng, Chen Huan, Ma Liangxiao. Effect of acupuncture at Renying(ST 9) on gene expression profile of hypothalamus in spontaneously hypertensive rats [J]. Journal of Traditional Chinese Medicine, 2018, 38(02): 227-241.
[4]	Wang Yili, Tian Yuanxiang, Zhao Jianxin, Xu Lei. Effect of electroacupuncture on gene expression in calcium signaling pathway in hippocampal cells in mice with cerebral ischemia reperfusion [J]. Journal of Traditional Chinese Medicine, 2017, 37(02): 252-260.
[5]	Chen Longhui, Yang Zemin, Chen Weiwen, Li Ruliu, Lin Chuanquan, Guan Lihua, Zhu Zhangzhi, Chen Ruifang, Li Saimei, Zhao Lingbo, Zeng Jinhao, Wang Jianhua. Differential expression of immune-related genes between healthy volunteers and type 2 diabetic patients with spleen-deficiency pattern [J]. Journal of Traditional Chinese Medicine, 2015, 35(06): 646-652.
[6]	Guo Yan, Xie Xiaojia, Guo Changqing, Wang Zhaoyang, Liu Qingguo. Effect of electro-acupuncture on gene expression in heart of rats with stress-induced pre-hypertension based on gene chip technology [J]. Journal of Traditional Chinese Medicine, 2015, 35(03): 285-294.
[7]	Bingbing Han, Shijun Wang, Lin Li, YuanWang, Haijun Zhao. Gene expression profiling of rat livers with Yin-deficiency-heat syndrome [J]. Journal of Traditional Chinese Medicine, 2013, 33(03): 378-383.

Home

Online First

Author Center

Reviewer Center

Issues

Announcement

About Us